Fisheries and Aquatic Sciences
The Korean Society of Fisheries and Aquatic Science
RESEARCH ARTICLE

Prevalence of chloramphenicol-resistant gene in Escherichia coli from water sources in aquaculture farms and rivers of Kuching, Northwestern Borneo

Sui Sien Leong1,*https://orcid.org/0000-0002-7050-2802, Samuel Lihan2https://orcid.org/0000-0001-6791-4390, Seng Chiew Toh1https://orcid.org/0000-0002-4279-5062
1Department of Animal Sciences and Fishery, Faculty of Agricultural and Forestry Sciences, Universiti Putra Malaysia, Nyabau Road, Bintulu 97008, Sarawak, Malaysia
2Institute of Biodiversity and Environmental Conservation, Universiti Malaysia Sarawak, Kota Samarahan 94300, Sarawak, Malaysia
*Corresponding author: Sui Sien Leong, Department of Animal Sciences and Fishery, Faculty of Agricultural and Forestry Sciences, Universiti Putra Malaysia, Nyabau Road,Bintulu 97008, Sarawak, Malaysia, Tel: +60-86-855822, Fax: +60-86-855388, E-mail: leongsuisien@upm.edu.my

Copyright © 2022 The Korean Society of Fisheries and Aquatic Science. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Oct 15, 2021; Revised: Dec 01, 2021; Accepted: Feb 02, 2022

Published Online: Apr 30, 2022

Abstract

Antibiotic resistant Escherichia coli cases are increasing high especially in Southeast Asia. Illegal use of the antibiotic in the aquaculture farming may become the culprit of the outbreak and spread into environmental source. A study was conducted to: 1) detect the chloramphenicol (CAL)-resistant gene in E. coli isolated from three aquaculture farms and six rivers of northwestern Borneo and 2) investigate the correlation between cat gene with five common antibiotics used. Isolation of E. coli was done on Eosin methylene blue agar and characterized using indole, methyl red, Voges-Proskauer, citrate tests. E. coli isolates were subsequently tested for their susceptibility to five antibiotics commonly used in aqua-farming. The CAL-resistant E. coli were further analyzed for the presence of resistant genes (cat I, cat II, cat III, cat IV) using multiplex polymerase chain reaction. 42 bacterial colonies were isolated from a total of 80 individual water samples, 34 of which were identified as E. coli. Result showed 85.3% of the E. coli isolates were resistant to amoxicillin, 35.3% were resistant to tetracycline, 29.4% were resistant to CAL, 17.6% were resistant to nitrofurantoin and 8.8% were resistant to nalidixic acid. All of the 10 CAL resistant E. coli isolateswere detected with cat II genes; five isolates detected with cat IV genes; three isolates detected with cat III genes; and another two detected with cat I genes. Pearson correlation coefficient shows highly significant relationship between resistance pattern of CAL with amoxicillin; and CAL with tetracycline. Our findings provide the supplementary information of the CAL resistance gene distribution, thereby improving our understanding of the potential risk of antibiotic resistance underlying within this microbial ecosystem.

Keywords: Chloramphenicol; cat genes; Escherichia coli; Aquaculture farms; Rivers

Introduction

The alarming situation of chloramphenicol (CAL) antibiotic resistant has become a global concern, especially in the aquatic environment. The situation is worsened by pollution from industry, agriculture, or domestic life, hence, making the aquatic environment an ideal setting for the transmission of antibiotic resistance genes in the ecosystem. Water sources are closely related to human life’s daily activities. Direct or indirect contact with water contaminated by such antibiotic resistant bacteria could harm and infect the human populace. Global dissemination of increasingly antibiotic resistant bacteria in developing countries is caused by the uncontrolled fecal disposal to surface water as mentioned by Manyi-Loh et al. (2018). The resistant gene carried by the bacteria can also migrate to microorganisms in humans via horizontal gene transfer (Bello-López et al., 2019).

CAL is a broad-spectrum antibiotic effective against both gram-positive and gram-negative bacteria (Lorenzo, 2019). It is commonly apply in aquaculture as a disinfectant or chemotherapeutic agent in treating fish diseases. The use of CAL in treating bacterial infection in food-producing animals has been prohibited in Malaysia since 1998 as stated in Malaysia Food Act 1983 (Act 281) & Regulations (Ministry of Health, 2014) as it can cause detrimental effects to human health. The European Union had ceased all aquaculture food imports from Asian countries in 2001 due to illegal CAL. CAL can cause thrombocytopenia, bone marrow depression, and aplastic anemia and produce positive results for genotoxicity in consumers (Keen & Montforts, 2012).

Shade et al. (2012) found that there is a fundamental relationship between the level of antibiotic characteristics and the distance from the disturbed stream. At the discharge site of the sewage treatment facility, it was found that an abundance of antibiotic resistant bacteria was present, but the concentration decreases gradually as the distance from the discharge site increased (Lupan et al., 2017). The water used in aquaculture is often discharged into the sea or river along with other pollutants from aquaculture farms. The contamination from sewage combined with the use of CAL will encourage the development of high resistance bacteria. If the food source is to be contaminated with CAL resistant bacteria, it may increase the risk of the microflora bacteria population inside the consumers developing antibiotic resistance. Bacteria typically develop resistance to CAL in the presence of plasmid-encoded or chromosomally encoded enzyme named chloramphenicol acetyltransferases or CAT. Huang et al. (2017) stated that CAT inactivates the effect of CAL by acetylation. The bacteria can develop CAL resistance by two separate events. Firstly, CAT catalyzes the transfer of an acetyl group from acetyl-coenzyme A to the 3-hydroxyl group of CAL (Biswas et al., 2012) to generate 3-O-acetyl-CAL, preventing it from binding to ribosomes (Huang et al., 2017). Secondly, a non-enzymatic event will occur, which begins with subsequent transfer of the acetyl group of acetyl-coenzyme A to the neighboring 1-hydroxyl group to generate 1-O-acetyl-CAL, resulting in a di-acetylated CAL (Kleanthous et al., 1984).

The CAT enzymes are divided into three types, namely cat I, cat II, and cat III. Genomic analysis of cat I, which is present in most pathogens, displays a modest sequence identical to cat II (46%) and cat III (32%–47%) (Biswas et al., 2012). A quadruple mutant of cat III named cat IV was introduced, cat IV has mutated catalytic pocket residues to mimic cat I reactions (Biswas et al., 2012). cat I was well documented and reported as a proteomic tool in a common CAL-resistance marker encoded in plasmids (Li et al., 2011a; Li et al., 2011b; Speck et al., 2011). The cat II enzyme is the only enzyme with extreme susceptibility to thiol-modifying agents compared with other cat enzymes (Murray et al., 1990) and can be found in many transposable elements (Roberts & Schwarz, 2017). The cat III enzyme is responsible for conferring resistance of the antibiotic CAL to the cell. Structural and biochemical studies of cat III were well studied to understand the general features of cat I proteins (Barsukov et al., 1996). The sequence differences between cat I, cat II, cat III, and cat IV include several substitutions in the binding site which may cause positional differences of CAL bound to these two proteins (Biswas et al., 2012). Studies have shown that E. coli bacteria are more prompt to develop antibiotic resistance if they are exposed to an increasingly high concentration of antibiotics in the surrounding environment (Tonoyan et al., 2019).

Sarawak, a state in Malaysia, is one of the most developed states. The Rajang River serves the cities on the northwest coast of Borneo. Unfortunately, the rivers and streams are dangerously polluted from the cities’ discharges (Leong et al., 2018). One of the many pollutants seeping into the waters is antibiotics via animal waste (Leong et al., 2020) or manure fertilization (Zhang et al., 2017). In Malaysia, manure is often recycled as cheap fertilizers for plantations. There are two antibiotics CAL and nitrofurans that are currently banned in Malaysia for use in agriculture since 1998 (Ministry of Health Malaysia, 2014). Farmers still illegally purchase and use CAL in most meat production (Berendsen et al., 2010). As a result, the leaching of CAL antibiotics from the fertilizer may find its way into the stream, thereby spreading into environmental bacteria (Manyi-Loh et al., 2018). Contaminants in the Food Chain (CONTAM) of European Food Security Authority (EFSA, 2014) also stated that the CAL will travel through the land system and end up contaminating the water source. In 2001, the detection of CAL in prawns happened in European countries, Australia and Asian countries such as Cambodia, Indonesia has sparked controversy because some argued that it was a huge economical waste to dispose of all the shrimp when there were only low levels of CAL found in the prawns (FAO, 2008). The use of CAL has been banned in Malaysia because it poses a serious risk to human health (Ng et al., 2014). However, the United States Food and Drug Administration (USFDA) had stopped 18 shipments from 11 Malaysian shrimp exporters due to the CAL detection in 2019 and 56 shipment of shrimp samples contained nitrofurans between 2009 and 2018 (The Straits Times, 2020). The aquaculture farms selected in the study are shrimp, prawn breeding, freshwater fish fry hatchery farms for export and the rivers are the mainstream connecting and covering the region which may be polluted by the drainage from the farms. They are the only commercial farms accessible in the area. E. coli is an opportunistic pathogen that can endure well in an aquatic system and is exceptionally proficient at horizontal gene transfer, which is considered as the vector for dissemination of antibiotic resistance (Javadi et al., 2017; Lihan et al., 2021). Odonkor & Addo (2018) have found that most antibiotic resistant E. coli can transmit their antibiotic resistance to other waterborne pathogens in drinking water. In this study, we collected water samples either from the aquaculture farms or rivers flowing from the Rajang River to 1) detect the CAL resistant gene (cat) in E. coli isolated and 2) investigate the correlation between cat gene with five common antibiotics used. We hypothesized that (1) E. coli isolates from different water sources may have different antibiotic resistance levels may detect at least one kind of cat gene and (2) there is a correlation between the CAL resistances with other antibiotics tested.

Materials and Methods

Study area description

The study was conducted in three selected aquaculture farms and eight rivers in the Kuching Division, namely FW: PM Aquaculture Farms (1°28’12.9N, 110°19’51.5E), FAS: Asia Aquaculture Farms (1°36’01.2N, 110°24’29.2E), BK: FBako Aquaculture Farms (1°36’01.0N, 110°24’29.5E); RB: Bako River (1°40’48.6N, 110°22’30.8E); RBT: Bintawa River (1°35’49.5N, 110°22’30.8E), RDM: Buntal River (1°40’48.6N, 110°22’34.9E), RMT: Muara Tuang River (1°29’42.7N, 110°23’41.3E), RST: Santubong River (1°39’32.0N, 110°21’00.9E), RSN: Siniawan River (1°26’48.3N, 110°13’10.9E), RWF: Sarawak River (1°33’41.1N, 110°23’58.9E), RWC: Windcave River (1°24’52.8N, 110°08’15.2E). Sarawak is a state in Malaysia that stretches along the Northwest coastal area of Borneo. It is one of the major oils and gas and agriculture producers in Malaysia. The climate is tropical with alternate rain (October to March 2019) and dry seasons (April to September 2019). The total monthly rainfall ranged between 374–458 mm during the rainy seasons (Malaysia Meteorological Department, 2019). The water bodies receive residential waste and drainage of nearby farms along with the year-round runoff from the plantations. PM Aquaculture Farms are well-established hatchery supplying the majority of the freshwater fish fry in Sarawak; Asia Aquaculture Farms are well-established exporters for shrimp farming in Sarawak; Bako Aquaculture Farms are established exporters for freshwater fishes and prawn in Sarawak.

Samples collection

A total of 80 individual water samples not including triplicate were collected from each farm and river from April to September 2019 using sterile 50 mL falcon tubes. The river water samples were collected upstream from the bridge with fast-moving water. The samples were collected from the surface water and bottom (3–4 feet, 121 cm depth) of each source and placed inside an icebox to avoid adverse compositional change in the total bacterial count for further analysis in the laboratory.

E. coli isolation and characterization

The water samples were serial diluted and 20 µL of the mixture was plated on Eosin-Methylene Blue (EMB) agar (Oxoid, Basingstoke, UK) and then incubated for 24–48 hours at 28°C. Only bacterial colonies with green metallic colours were sub-cultured on new EMB agar to obtain a pure colony. The presumptive E. coli was further confirmed with indole-methyl red-Voges Proskauer-citrate (IMViC) tests which involved Sulfide-Indole-Motility (SIM), Methyl Red and Voges-Proskauer (MR-VP) and citrate tests following the standard method (Al-Baer & Hussein, 2017). The control was set using E. coli strain ATCC 25922 (Thermo Fisher Scientific, Waltham, MA, USA) and Enterobacter aerogenes (ATCC13048).

DNA extraction and 16S rRNA polymerase chain reaction (PCR)

The presumptive E. coli DNAs were extracted using the boiling method as described by Sien et al. (2013) with minor modification. Total of 2 µL of DNA (10 pg) was extracted and placed directly on the spectrophotometer (NanoDrop, Thermo Fisher Scientific) for measurement at 230, 260, and 280 nm in order to assess DNA purity. The identification of the isolates was analyzed with 16S rRNA PCR by amplifying the 16S ribosomal RNA gene (Sien et al., 2013). The primers 27F 5’-AGAGTTTGATCMTGGCTCAG-3’ and 519R 5’-GWATTACCGCGGCKGCTG-3’ (Promega, Madison, WI, USA) were used in the PCR amplification. The PCR reactions (Promega) were performed in reaction mixtures containing 20 μL DNA (10 pg), 1.0 μL every 20 pmol primers, 3 μL of 10 mM deoxynucleoside triphosphates mix, 6.0 μL of 25 mM MgCl2, 10.0 μL of 5X Buffer solution, 8.0 μL of distilled water, and 1 μL of Taq polymerase. PCR was performed as follows: initial denaturation at 95°C for 10 min, denaturation at 94°C for 30 sec, annealing at 55°C for 1 min, primer extension 72°C for 1.5 min with 35 cycles and the final extension at 72°C for 10 min. Finally, the PCR products were visualized with ethidium bromide staining after gel electrophoresis in 1% agarose for 30 min at 90 V.

Sequencing analysis

The 16S ribosomal DNA was purified using the Qiagen sequencing purification kit (QIAquick Gel Extraction Kit, QIAGEN, Hilden, Germany). The purified DNA product was sent to Apical Scientific Sdn. Bhd., Malaysia, for the DNA sequencing process. All 16S rRNA sequences were compared using the BLAST program to determine the closest identity matches.

Evaluation of antibiotic resistance

The E. coli isolates were analyzed using the disk diffusion method stated in the standard procedure of the Clinical and Laboratory Standards Institute (CLSI, 2020) to evaluate its antibiotic resistance. The E. coli isolates were tested against amoxicillin (3 μg/ mL) (Oxoid), tetracycline (30 μg/ mL) (Oxoid), nitrofurantoin disk (300 μg/ mL) (Oxoid), nalidixic acid (30 μg/ mL) (Oxoid), and CAL (30 μg/ mL) (Oxoid). Reference culture (E. coli ATCC 25922) was used as a control. The test was performed in duplicate. The formation of clear zones was recorded and the susceptibility results were compared to the standard set by the CLSI (2020).

Detection of chloramphenicol resistant gene

Multiplex PCR assays were used to determine the presence of CAL resistance genes in CAL-resistant E. coli. There were four sense primers c to detect the cat I, cat II, cat III, and cat IV genes. The antisense primer C-R was also added for PCR amplification. The sequence of each primer was listed in Table 1. The multiplex PCR was performed in a total volume of 25 μL using 5X Green GoTaq kit (Promega): 5 μL PCR buffer solution (5 μ/μlL), 3 μL 50 mM MgCl2, 0.8 μL of 2 mM dNTP mix, 1 μL of each primer, 0.3 μL of Taq DNA polymerase, 6.9 μL of sterile distilled water, 4 μL of crude DNA. The thermal cycling condition of multiplex PCR in cat gene amplification was started with an initial denaturation at 95°C (3 min), next by denaturation, annealing, and extension (34 cycles) at 95°C (1 min), 54°C (1 min), and 72°C (1 min), respectively. Final extension was carried out at 72°C for 5 mins. Amplification was performed in a PCR machine: Bioer Little Genius thermal-cycler (Bioer, China). A positive control (DUS-WF-6: E. coli containing cat genes obtained from Universiti Malaysia Sarawak [Ng et al., 2014]), a negative control (Pseudomonas aeruginosa ATCC 27853) and a blank control were employed in this assay. The temperature program was set according to Ng et al. (2014). The amplification products were analyzed by electrophoresis in a 1.0% (w/v) agarose at 80 V, 200 mA for 60 min. A 1kb DNA ladder (Promega) was used and the amplified fragments were visualized with a UV transilluminator.

Table 1. Primer sets for the detection of cat I, cat II, cat III, and cat IV genes in this study
Primers Target genes Primer sequence (5’-3’) Product size (bp)
C-1 cat I GGTGATATGGGATAGTGTT 349
C-2 cat II GATTGACCTGAATACCTGGAA 567
C-3 cat III CCATACTCATCCGATATTGA 275
C-4 cat IV CCGGTAAAGCGAAATTGTAT 451
C-R - CCATCACATACTGCATGATG -
Download Excel Table

Results and Discussion

Out of 42 bacterial colonies, 34 isolates were positive in the IMViC tests and were confirmed as E. coli. The result showed the presence of E. coli in Asia Aquaculture Farm (FAS-NS(S), FAS-SD1(S), FAS-RV1(S), FAS-R10(B), FAS-8(S), FAS-16(S), FAS-16(B), FAS-42(S), FAS-62(S), FAS-62(B)), FAS-SD2(B)), Bako Aquaculture Farm (FBK2-K4(S), FBK2-OLT(S), FBK2-OLT(B), FBK2-K2(B), FBK-RV2(S)), Bako River (RBK-S2-A), Bintawa River (RBT-S1-A, RBT-S3-A), Buntal River (RDM-S1-A, RDM-S2-A, RDM-S3-A), Muara Tuang River (RMT-S1-A, RMT-S1-B), Siniawan River (RSN-S1-A, RSN-S2-A), Windcave River (RWC-S1-A, RWC-S3-A, RWC-S3-B), Sarawak River (RWF-S1-A, RWF-S2-A, RWF-S3-A, RWF-S3-B). E. coli isolates were distributed almost equally between the aquaculture farms (n = 15) and rivers (n = 16).

The antibiotic susceptibility test of the 34 E. coli isolates against five different aqua-farming antibiotics is illustrated in Figs 12. The result showed that 85.3% of E. coli isolates were resistant against amoxicillin, followed by 35.3% were resistant against tetracycline, 29.4% were resistant against CAL, 17.6% were resistant against nitrofurantoin (17.6%), and 8.8% were resistant against nalidixic acid (8.8%) (Fig. 2). Most of the E. coli isolated either from farms or rivers were resistant against amoxicillin and tetracycline. Both antibiotics are broad-spectrum antibiotics commonly used to treat bacterial infections in fish. E. coli isolates that were resistant towards CAL were also resistant towards tetracycline except for FAS-16(B) and RBK-RV2(S). Among the 10 CAL resistant isolates, seven isolates were from environmental samples and another three isolates originated from aquaculture farms.

fas-25-4-202-g1
Fig. 1. The antibiotic susceptibility test results examples of Escherichia coli against five different antibiotics according to CLSI (2020). A, control (E. coli ATCC 25922); B & C, E. coli isolates (RSN-S1-A, RDM-S2-A).
Download Original Figure
fas-25-4-202-g2
Fig. 2. The antibiotic susceptibility test of Escherichia coli against five antibiotics: amoxicillin, tetracycline, chloramphenicol, nitrofurantoins, and nalidixic acid according to CLSI (2020). Control, E. coli ATCC 25922.
Download Original Figure

Amoxicillin was the most prevalent antibiotic detected in this study. The result was in agreement with Turnipseed et al. (2018), who detected a high level of amoxicillin residue in catfish, trout, and even in salmon farms by liquid chromatography high-resolution mass spectrometry (LC-HRMS) screening in Europe. 85.3% of amoxicillin resistant E. coli detected in the study was lower as compared to Lihan et al. (2021), who stated 100% amoxicillin resistance detected in E. coli isolated from aquaculture farms in Sarawak, Borneo. Zakaria (2017) reported that tetracycline is the second-highest antibiotic used in Malaysia up to 73,910 kg per year. This is because tetracycline antibiotics are cheap and have high efficacy against bacteria, parasites, and fungi. Tetracycline is commonly administered in water to be absorbed by the fish gills, thus the antibiotic residue is easily drained into the environment. Our result showed CAL as top three most prevalent antibiotics detected. CAL exhibits antibacterial properties by stopping the protein production in bacterial growth, thereby slowing down their infestation and multiplication (Dinos et al., 2016) whereas tetracycline is also known to inhibit bacterial protein synthesis (Chukwudi, 2016). Fig. 2 showed 6 E. coli isolated from Asia aquaculture farm and Bako Aquaculture farm was resistant to nitrofurantoin antibiotic. CAL and nitrofurantoin were banned in farming since 1998, but obviously, these two prawn and shrimp breeding farms are still applying these antibiotics in treating diseases. Most Southeast Asian countries are lacking regulatory surveillance and monitoring systems on the use of banned antibiotics (FAO & WHO, 2020). Thus, illegal usage of antibiotic cases especially in the environment, and aquaculture products are still available globally (Lai et al., 2018). Banned antibiotics such as CAL and nitrofurantoin were still detectable in our study was supported by Thiang et al. (2021), who detected tetracyclines, sulfonamides and quinolones in wastewater draining from Malaysian aquaculture farms in most Peninsular Malaysia. Thiang et al. (2021) indicated a wide distribution of antibiotics used in most aquaculture farms in Malaysia and become a resistance hotspot in promoting the growth of antibiotic resistant bacteria. Antibiotics residue in manure and other waste-based fertilizers may run off into waterways by exchanging resistance genes and altering the microbial community in water and sediment (Lihan et al., 2021). Thus, it may contribute to antibiotic resistance bacteria cases in our study. Only three E. coli were resistant to nalidixic acid (Fig. 2). Our antibiotic resistance result was higher compared to Ramírez Castillo et al. (2013), who has detected CAL (22%) and nitrofurantoin (7.7%) resistant E. coli found in rivers water in Aguascalientes, Mexico. Quinolone resistance such as nalidixic acid resistance is quite rare and resides commonly in fecal flora. Our result detected 8.8% nalidixic acid resistance E. coli, which is slightly higher compared to 13.7% resistance cases being reported in Ghana, Africa (Namboodiri et al., 2011).

In this study, we proceed to investigate the cat genes carried by the ten CAL resistant E. coli isolates. E. coli is an indicator organism that is suitable for determining CAL resistance of bacteria in Southeast Asian aquaculture environments as they are the only widespread group of CAL resistance heterotrophs that are not restricted by geographical region (Mohamed et al., 2015). E. coli is the host-specific which indicates fecal contamination in the water (Zhi et al., 2015).

The outcomes of the partial 16S rRNA sequencing homology search (BLAST) of ten E. coli isolates are shown in Table 2. The 482 genome sequences with the primer pair 27F-519R covering V1 to V3 region in 16s rRNA gene were sequenced. All the 10 isolates were identified as E. coli with 99% similarity compared to the reference genome in BLAST NCBI.

Table 2. The partial genome (482 genome sequences with the primer pair 27F-519R covering V1 to V3 region in 16s rRNA gene) of the 16S rRNA sequencing homology search (BLAST NCBI) results of Escherichia coli isolated from 3 aquaculture farms and 6 rivers in northwest coast of Borneo
Isolates Identification Sources Similarity % compared with reference genome
RBK-S2-A Escherichia coli GeneBank 99
RDM-S1-A Escherichia coli GeneBank 99
RDM-S2-A Escherichia coli GeneBank 99
RDM-S3-A Escherichia coli GeneBank 99
RWF-S1-A Escherichia coli GeneBank 99
RSN-S1-A Escherichia coli GeneBank 99
RSN-S2-A Escherichia coli GeneBank 99
FAS-RV1(S) Escherichia coli GeneBank 99
FBK2-OLT(B) Escherichia coli GeneBank 99
FBK2-K2 Escherichia coli GeneBank 99

Ladder of 100 bp (Promega) was used as a size indicator for bands. A positive control (DUS-WF-6 isolates), a negative control (Pseudomonas aeruginosa ATCC 27853) and a blank control were employed in this assay.

Download Excel Table

The electrophoresis result of multiplex PCR products amplified with primers C-1, C-2, C-3, C-4, and C-R are shown in Figs 3A and 3B. Fig. 3A depicts the isolates of RDM-S2-A, and RDM-S3-A detected with cat I genes compared with positive control. Fig. 3B shows all of the PCR products of E. coli that were detected with cat II genes. RSN-S1-A, RSN-S2-A and FBK2-K2 (Fig. 3A) were detected with cat III genes whereas RBK-S2-A, RDM-S1-A, RWF-S1-A, FAS-RV1(S), and FBK2-OLT(B) were detected with cat IV genes (Fig. 3B). Table 3 describes the overall CAL resistance gene detection in E. coli isolates. The results revealed that ten E. coli isolates were presented with cat II genes, two isolates were detected with cat I genes, three isolates were detected with cat III genes and five isolates were detected with cat IV genes.

fas-25-4-202-g3
Fig. 3. Multiplex PCR of the chloramphenicol resistance Escherichia coli isolates from 3 aquaculture farms and 6 rivers in Northwest Coast of Borneo. (A) Lane M: 100 bp ladder; lane 1, positive control (DUS-WF-6); lane 2, RBK-S2-A; lane 3, RDM-S1-A; lane 4, RDM-S2-A; lane 5, RDM-S3-A; lane 6, RWF-S1-A; lane 7, RSN-S1-A; lane 8, RSN-S2-A; lane 9, FAS-RV1(S); lane 10, FBK2-OLT(B); lane 11, FBK2-K2; lane 12, negative control (Pseudomonas aeruginosa ATCC 27853); cat I (349 bp; shown as yellow arrow); cat III (275 bp; shown as orange arrow). (B) Lane M: 100 bp ladder; lane 1 and 2, positive control (DUS-WF-6); lane 3, RDM-S1-A; lane 4, RDM-S2-A; lane 5, RDM-S3-A; lane 6, RWF-S1-A; lane 7, RSN-S1-A; lane 8, RSN-S2-A; lane 9, FAS-RV1(S); lane 10, FBK2-OLT(B); lane 11, FBK2-K2; lane 12, negative control (Pseudomonas aeruginosa ATCC 27853); cat II (567 bp; shown as red arrow); cat IV (451 bp; shown as blue arrow).
Download Original Figure
Table 3. The chloramphenicol resistance gene detection in Escherichia coli isolated from aquaculture farm and rivers
Lane E. coli isolate Chloramphenicol resistant gene
cat I (349 bp) cat II (567 bp) cat III (275 bp) cat IV (451 bp)
1 Positive control + +
2 RBK-S2-A + +
3 RDM-S1-A + +
4 RDM-S2-A + +
5 RDM-S3-A + +
6 RWF-S1-A + +
7 RSN-S1-A + +
8 RSN-S2-A + +
9 FAS-RV1(S) + +
10 FBK2-OLT(B) + +
11 FBK2-K2 + +

Positive control, DUS-WF-6; +, indicates the presence of cat genes; –, indicate the absence of cat genes.

Download Excel Table

Antimicrobial resistance indicators are theoretically omnipresent in the environment where the presence of such indicators is readily observed and possess genetic flexibility that allows them to obtain mobile resistance elements (Singer et al., 2016). The transferable genes encoding CAT are responsible for the antibiotic resistant characteristic of E. coli towards CAL (Munita & Arias, 2016). Furthermore, E. coli is believed to be the reservoir of other resistant genes. The resistance gene in E. coli can be transferred to other zoonotic or commensal organisms causing drug resistance in humans or cattle which can hinder standard treatment protocol (Djordjevic et al., 2013; Salinas et al., 2019).

Research has found that CAL resistance is genetically related to two different mechanisms. The first mechanism is the CAT enzymes encoded in cat genes that convert CAL into harmless molecules as discussed in this study (cat I, cat II, cat III, and cat IV genes). The second mechanism is the change in permeability to antibiotics through the efflux mechanism controlled by cmIA genes (Munita & Arias, 2016). Gene cmlA confers as non-enzymatic CAL resistance acquired via an efflux mechanism and resembles cmIA protein identified in most Pseudomonas spp. Thus, in this study cat gene is widely applied especially in CAL resistance in Gram negative bacteria (Miranda et al., 2015). For this study, all the CAL resistant E. coli isolates demonstrated two types of cat genes. The CAL resistant E. coli must exhibit at least two cat gene which encodes CAT in order to inactivate the drugs CAL by acetylation. This was proven by Martinez & Baquero (2000) that high-level resistance frequently requires mutations in more than one gene. The result was supported by Ng et al. (2014), who detected 19 E. coli isolates with cat I, 13 E. coli isolates with cat II, 10 E. coli isolates with cat III and 6 E. coli isolates with cat IV genes found in water samples of aquaculture farms in Kuching, Malaysia. Pearson correlation coefficient shows a highly significant relationship between resistance pattern of CAL with amoxicillin; and CAL with tetracycline. CAL and amoxicillin resistance occurred in E. coli isolated are significantly correlated (p = 0.026, r = 0.382, n = 34). CAL and tetracycline resistance occurred in E. coli isolated are highly significantly correlated (p = 0.001, r = 0.824, n = 34). The result was different compared to Zhang et al. (2014) who revealed significant correlations were found frequently among tetracycline, chlortetracycline, and quinolone resistance. Significant correlations between resistance to tetracycline and CAL were shown by Chen et al. (2011). These strong correlations among the top three most prevalent antibiotics may cause by co-selection (Dang et al., 2006). Studies showed that many antibiotic resistance genes are located on a similar plasmid (Carattoli, 2013), thus, these may result in the correlations found among resistance to different antibiotics.

Although low number of CAL resistant bacteria was detected among E. coli isolates found in aquaculture farms, this study further substantiates the presence of CAL in the environment. The correlation relationship of amoxicillin, tetracycline, and CAL are interrelated. The misuse of CAL as an antibiotic by local aqua-culturists despite being banned by the European Union (Tsai et al., 2019) may also trigger amoxicillin and tetracycline resistant bacteria. According to Munita & Arias (2016), the manifestation of the antibacterial resistance among bacteria that share similar properties may vary with time or period due to certain environmental and biological factors. Based on the current findings, E. coli isolated from the river samples contained a higher percentage occurrence of antibiotic resistance if compared to isolates found in aquaculture farms. Li et al. (2013) stated that a dramatic decline in temperature, pH, and dissolved oxygen in recent years, along with river runoff and sewage discharge may have caused temporal and spatial shifts in the population of antibiotic-resistant bacteria. Nonetheless, factors that determine CAL resistances in bacteria vary with environments and geological locations. Thus, monitoring the antibiotic resistance bacteria especially CAL resistance in both farms and the environment is vital before causing devastating effects to the ecosystem.

Conclusion

Total 34 of E. coli isolated from aquaculture farm and environmental water. The E. coli was resistant to amoxicillin (85.3%), tetracycline (35.3%), CAL (29.4%), nitrofurantoin (17.6%), and nalidixic acid (8.8%) antibiotics. Ten CAL resistant E. coli isolates were detected with cat II gene (100%), followed by cat IV gene (50%) and cat III gene (30%) and cat I genes (20%). All isolates contain at least two different cat genes in order to show resistance trait. Pearson correlation coefficient is showing a strong relationship between CAL with amoxicillin; and CAL with tetracycline.

Supplementary Materials

Supplementary Materials

fas-25-4-202-suppl1.pdf

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This work was supported by the Grant Putra at Universiti Putra Malaysia through research (no. GP/2020/9692700).

Acknowledgements

We are grateful to the supporting laboratory staffs of virology laboratory, microbiology laboratory, Universiti Malaysia Sarawak, Malaysia and biocompound laboratory, Universiti Putra Malaysia Campus Bintulu, Malaysia where laboratory analysis were conducted.

Availability of data and materials

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Ethics approval and consent to participate

This article does not require IRB/IACUC approval because there are no human and animal participants.

References

1.

Al-Baer A, Hussein AA. Isolation and identification of Escherichia coli producing cytosine deaminase from Iraqi patients. Int J Adv Res Biol Sci. 2017; 4:1-6

2.

Barsukov IL, Lian LY, Ellis J, Sze KH, Shaw WV, Roberts GCK. The conformation of coenzyme A bound to chloramphenicol acetyltransferase determined by transferred NOE experiments. J Mol Biol. 1996; 262:543-58

3.

Bello-López JM, Cabrero-Martínez OA, Ibáñez-Cervantes G, Hernández-Cortez C, Pelcastre-Rodríguez LI, Gonzalez-Avila LU, et al. Horizontal gene transfer and its association with antibiotic resistance in the Genus Aeromonas spp. Microorganisms. 2019; 7:363

4.

Berendsen B, Stolker L, de Jong J, Nielen M, Tserendorj E, Sodnomdarjaa R, et al. Evidence of natural occurrence of the banned antibiotic chloramphenicol in herbs and grass. Anal Bioanal Chem. 2010; 397:1955-63

5.

Biswas T, Houghton JL, Garneau-Tsodikova S, Tsodikov OV. The structural basis for substrate versatility of chloramphenicol acetyltransferase CATI. Protein Sci. 2012; 21:520-30

6.

Carattoli A. Plasmids and the spread of resistance. Int J Med Microbiol. 2013; 303:298-304

7.

Chen B, Zheng W, Yu Y, Huang W, Zheng S, Zhang Y, et al. Class 1 integrons, selected virulence genes, and antibiotic resistance in Escherichia coli isolates from the Minjiang River, Fujian Province, China. Appl Environ Microbiol. 2011; 77:148-55

8.

Chukwudi CU. rRNA binding sites and the molecular mechanism of action of the tetracyclines. Antimicrob Agents Chemother. 2016; 60:4433-41

9.

Clinical and Laboratory Standards Institute [CLSI]. Performance standards for antimicrobial susceptibility testing; twenty-second informational supplement. Wayne, PA: CLSI. 2020.

10.

Dang H, Song L, Chen M, Chang Y. Concurrence of cat and tet genes in multiple antibiotic-resistant bacteria isolated from a sea cucumber and sea urchin mariculture farm in China. Microb Ecol. 2006; 52:634-43

11.

Dinos GP, Athanassopoulos CM, Missiri DA, Giannopoulou PC, Vlachogiannis IA, Papadopoulos GE, et al. Chloramphenicol derivatives as antibacterial and anticancer agents: historic problems and current solutions. Antibiotics. 2016; 5:20

12.

Djordjevic SP, Stokes HW, Roy Chowdhury P. Mobile elements, zoonotic pathogens and commensal bacteria: conduits for the delivery of resistance genes into humans, production animals and soil microbiota. Front Microbiol. 2013; 4:86

13.

EFSA Panel on Contaminants in the Food Chain [EFSA CONTAM Panel]. Scientific opinion on chloramphenicol in food and feed. EFSA J. 2014; 12:3907

14.

Food and Agriculture Organization of the United Nations [FAO]. Global study of shrimp fisheries.In In: Gillet R, editor.editor FAO fisheries technical paper. Rome: FAO. 2008; p p. 12-5.

15.

Food and Agriculture Organization of the United Nations [FAO], World Health Organization [WHO]. Residue evaluation of certain veterinary drugs: Joint FAO/WHO Expert Committee on Food Additives - 88th Meeting 2019. Joint FAO/WHO Expert Committee on Food Additives (JECFA) Monographs No. 24. Rome: FAO and WHO. 2020.

16.

Huang L, Yuan H, Liu MF, Zhao XX, Wang MS, Jia RY, et al. Type B chloramphenicol acetyltransferases are responsible for chloramphenicol resistance in Riemerella anatipestifer, China. Front Microbiol. 2017; 8:297

17.

Javadi M, Bouzari S, Oloomi M. Horizontal gene transfer and the diversity of Escherichia coli.In In: Samie A, editor.editor Escherichia coli - Recent advances physiology, pathogenesis and biotechnological applications. London: IntechOpen. 2017; p p. 317-31

18.

Keen PL, Montforts MHMM. Antimicrobial resistance in the environment. Hoboken, NJ: John Wiley & Sons. 2012

19.

Kleanthous C, Shaw WV. Analysis of the mechanism of chloramphenicol acetyltransferase by steady-state kinetics. Evidence for a ternary-complex mechanism. Biochem J. 1984; 223:211-20

20.

Lai WWP, Lin YC, Wang YH, Guo YL, Lin AYC. Occurrence of emerging contaminants in aquaculture waters: cross-contamination between aquaculture systems and surrounding waters. Water Air Soil Pollut. 2018; 229:249

21.

Li H, Liu L, Li M, Zhang X. Effects of pH, temperature, dissolved oxygen, and flow rate on phosphorus release processes at the sediment and water interface in storm sewer. J Anal Methods Chem. 2013; 2013:104316

22.

Leong SS, Ismail J, Denil NA, Sarbini SR, Wasli W, Debbie A. Microbiological and physicochemical water quality assessments of river water in an industrial region of the northwest coast of Borneo. Water. 2018; 10:1648

23.

Leong SS, Lihan S, Chia HC. Genotypic profiles of virulent genes detected among the Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa isolated from swiftlets in Borneo. Malays J Microbiol. 2020; 16:275-84.

24.

Lihan S, Lee SY, Toh SC, Leong SS. Plasmid-mediated antibiotic resistant Escherichia coli in Sarawak rivers and aquaculture farms, northwest of Borneo. Antibiotics. 2021; 10:776

25.

Li W, Ruf S, Bock R. Chloramphenicol acetyltransferase as selectable marker for plastid transformation. Plant Mol Biol. 2011a; 76:443-51

26.

Li Z, He L, He N, Deng Y, Shi Z, Wang H, et al. Polymerase chain reaction coupling with magnetic nanoparticles-based biotin-avidin system for amplification of chemiluminescent detection signals of nucleic acid. J Nanosci Nanotechnol. 2011b; 11:1074-8

27.

Lorenzo D. Chloramphenicol resurrected: a journey from antibiotic resistance in eye infections to biofilm and ocular microbiota. Microorganisms. 2019; 7:278

28.

Lupan I, Carpa R, Oltean A, Kelemen BS, Popescu O. Release of antibiotic resistant bacteria by a waste treatment plant from Romania. Microbes Environ. 2017; 32:219-25

29.

Malaysia Meteorological Department. Weather forecast [Internet]. Malaysia Meteorological Department. 2019[cited 2019 Apr 3]https://www.met.gov.my/forecast/weather/state/St501

30.

Manyi-Loh C, Mamphweli S, Meyer E, Okoh A. Antibiotic use in agriculture and its consequential resistance in environmental sources: potential public health implications. Molecules. 2018; 23:795

31.

Martinez JL, Baquero F. Mutation frequencies and antibiotic resistance. Antimicrob Agents Chemother. 2000; 44:1771-7

32.

Ministry of Health Malaysia. Food Act 1983: Food (Amendment) (No. 3) Regulation 2014 [Internet]. 2014[cited 2022 Jan 21]https://www.fmm.org.my/images/articles/Draf-pindaan-PPM1985-Bil3-2014_draft%20food%20(amendment)%20reg%20(No%203)%202014.pdf

33.

Miranda CD, Rojas R, Geisse J, Romero J, González-Rocha G. Scallop larvae hatcheries as source of bacteria carrying genes encoding for non-enzymatic phenicol resistance. Mar Pollut Bull. 2015; 95:173-82

34.

Mohamed M, Owens K, Gajewski A, Clabots C, Johnston B, Thuras P, et al. Extraintestinal pathogenic and antimicrobial-resistant Escherichia coli contamination of 56 public restrooms in the Greater Minneapolis-St. Paul Metropolitan area. Appl Environ Microbiol. 2015; 81:4498-506

35.

Munita JM, Arias CA. Mechanisms of antibiotic resistance.In In: Kudva IT, editor.editor Virulence mechanisms of bacterial pathogens. Hoboken, NJ: John Wiley & Sons. 2016; p p. 481-511

36.

Murray IA, Martinez-Suarez JV, Close TJ, Shaw WV. Nucleotide sequences of genes encoding the type II chloramphenicol acetyltransferases of Escherichia coli and Haemophilus influenzae, which are sensitive to inhibition by thiol-reactive reagents. Biochem J. 1990; 272:505-10

37.

Namboodiri SS, Opintan JA, Lijek RS, Newman MJ, Okeke IN. Quinolone resistance in Escherichia coli from Accra, Ghana. BMC Microbiol. 2011; 11:44

38.

Ng KH, Samuel L, Kathleen MM, Leong SS, Felecia C. Distribution and prevalence of chloramphenicol-resistance gene in Escherichia coli isolated from aquaculture and other environment. Int Food Res J. 2014; 21:1321-5.

39.

Odonkor ST, Addo KK. Prevalence of multidrug-resistant Escherichia coli isolated from drinking water sources. Int J Microbiol. 2018; 2018:7204013

40.

Ramírez Castillo FY, Avelar González FJ, Garneau P, Márquez Díaz F, Guerrero Barrera AL, Harel J. Presence of multi-drug resistant pathogenic Escherichia coli in the San Pedro River located in the State of Aguascalientes, Mexico. Front Microbiol. 2013; 4:147

41.

Roberts MC, Schwarz S. Tetracycline and chloramphenicol resistance mechanisms.In In: Meyers D, Sobel J, Ouellette M, Kaye K, Marchaim D, editors.editors Antimicrobial drug resistance. Cham: Springer. 2017; p. p p. 231-42

42.

Salinas L, Cárdenas P, Johnson TJ, Vasco K, Graham J, Trueba G. Diverse commensal Escherichia coli clones and plasmids disseminate antimicrobial resistance genes in domestic animals and children in a semirural community in Ecuador. mSphere. 2019; 4:e00316-19

43.

Shade A, Peter H, Allison SD, Baho DL, Berga M, Bürgmann H, et al. Fundamentals of microbial community resistance and resilience. Front Microbiol. 2012; 3:417

44.

Sien LS, Chuan CH, Lihan S, Yee LT. Isolation and identification of airborne bacteria inside swiftlet houses in Sarawak, Malaysia. Makara J Sci. 2013; 17:104-8

45.

Singer AC, Shaw H, Rhodes V, Hart A. Review of antimicrobial resistance in the environment and its relevance to environmental regulators. Front Microbiol. 2016; 7:1728

46.

Speck J, Stebel SC, Arndt KM, Müller KM. Nucleotide exchange and excision technology DNA shuffling and directed evolution. Methods Mol Biol. 2011; 687:333-44

47.

The Straits Times. US food authority stops shrimps from some Malaysian exporters due to use of antibiotics [Internet]. The Straits Times. 2020[cited 2021 Nov 23]https://www.straitstimes.com/asia/se-asia/us-food-authority-stops-shrimps-from-some-malaysian-exporters-due-to-use-of-antibiotics

48.

Thiang EL, Lee CW, Takada H, Seki K, Takei A, Suzuki S, et al. Antibiotic residues from aquaculture farms and their ecological risks in Southeast Asia: a case study from Malaysia. Ecosyst Health Sustain. 2021; 7:1926337

49.

Tonoyan L, Fleming GTA, Friel R, O’Flaherty V. Continuous culture of Escherichia coli, under selective pressure by a novel antimicrobial complex, does not result in development of resistance. Sci Rep. 2019; 9:2401

50.

Tsai MY, Lin CF, Yang WC, Lin CT, Hung KH, Chang GR. Health risk assessment of banned veterinary drugs and quinolone residues in shrimp through liquid chromatography–tandem mass spectrometry. Appl Sci. 2019; 9:2463

51.

Turnipseed SB, Storey JM, Wu IL, Gieseker CM, Hasbrouck NR, Crosby TC, et al. Application and evaluation of a high-resolution mass spectrometry screening method for veterinary drug residues in incurred fish and imported aquaculture samples. Anal Bioanal Chem. 2018; 410:5529-44

52.

Zakaria BM. Use of antimicrobial agent in veterinary medicine in Malaysia (powerpoint slides) [Internet]. 2017[cited 2022 Jan 23]http://vam.org.my/home/wp-content /uploads/2017/11/Mazuki_AMU-in-Vet-Med.pdf

53.

Zhang H, Li X, Yang Q, Sun L, Yang X, Zhou M, et al. Plant growth, antibiotic uptake, and prevalence of antibiotic resistance in an endophytic system of pakchoi under antibiotic exposure. Int J Environ Res Public Health. 2017; 14:1336

54.

Zhang X, Li Y, Liu B, Wang J, Feng C, Gao M, et al. Prevalence of veterinary antibiotics and antibiotic-resistant Escherichia coli in the surface water of a livestock production region in northern China. PLOS ONE. 2014; 9e111026

55.

Zhi S, Li Q, Yasui Y, Edge T, Topp E, Neumann NF. Assessing host-specificity of Escherichia coli using a supervised learning logic-regression-based analysis of single nucleotide polymorphisms in intergenic regions. Mol Phylogenet Evol. 2015; 92:72-81