RESEARCH ARTICLE

Genetic characterization of alloherpesvirus (cyprinid herpesvirus-2 and koi herpesvirus) and poxvirus (carp edema virus) identified from domestic and imported cyprinids in Korea

Ye Jin Jeong1,#https://orcid.org/0000-0003-2372-416X, Yu Gyeong Jeon1,#https://orcid.org/0000-0002-7505-8130, Hee Ju Choi1https://orcid.org/0000-0001-8438-9030, Eun Jin Baek1https://orcid.org/0000-0002-3896-0213, Guk Hyun Kim1https://orcid.org/0000-0003-3953-0562, Yun Jung Yang1https://orcid.org/0000-0002-9620-1602, Min Jae Kim1https://orcid.org/0000-0002-0190-551X, Joon Gyu Min1https://orcid.org/0000-0001-6018-9747, Kwang Il Kim1,*https://orcid.org/0000-0001-7003-5696
Author Information & Copyright
1Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Korea
*Corresponding author: Kwang Il Kim, Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Korea, Tel: +82-51-629-5946, E-mail:kimki@pknu.ac.kr

# These authors contributed equally to this work.

Copyright © 2023 The Korean Society of Fisheries and Aquatic Science. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jan 30, 2023; Revised: Apr 18, 2023; Accepted: May 11, 2023

Published Online: Jul 31, 2023

Abstract

Cyprinids are popular species for aquaculture worldwide, with Asia being a significant contributor to their production. In Korea, common carp (Cyprinus carpio), koi carp (Cyprinus rubrofuscus), and goldfish (Carassius auratus) are cultivated domestically and imported for ornamental or human consumption purposes. Among the viruses that infect cyprinids, cyprinid herpesvirus-2 (CyHV-2), koi herpesvirus (KHV, also known as cyprinid herpesvirus-3), and carp edema virus (CEV) are of particular concern as they cause substantial economic losses to the aquaculture industry. In this study, we investigated these viruses in both of domestic and imported cyprinids. Our results revealed that CyHV-2 was only detected in imported goldfish from Thailand. To further investigate the genetic characteristics of them, the marker A region was analyzed. Despite belonging to the same cluster with isolates from China, France, Poland, and Israel, CyHV-2 detected in this study showed distinct differences in their repetitive sequence sizes. Furthermore, two different forms of KHV/CEV coinfection were identified from domestic koi carp, both of which exhibited typical symptoms. Phylogenetic analysis showed that one KHV isolate (ScKc-2105-K) was of the Asian type and closely related to isolates from Japan, Indonesia, Belgium, Taiwan, and China. Two CEV isolates (ScKc-2105-CE and GhKc-2207-CE) belonged to the IIa type and showed high similarity with isolates from the USA, France, and Korea. Notably, koi carp injected with cultured KHV (ScKc-2105-K) showed 78.0% cumulative mortality within 14 days post-injection (dpi). Our findings support the importance of regular surveillance of viral diseases in cyprinids.

Keywords: Koi herpesvirus; Cyprinid herpesvirus-2; Carp edema virus; Cyprinids; Transmission

Introduction

Family Cyprinidae is crucial in the fishery industry in Asian countries. Recently, worldwide reports indicate the presence of alloherpesviruses such as cyprinid herpesvirus-2 (CyHV-2), -3 (CyHV-3, commonly known as koi herpesvirus; KHV), and poxvirus including carp edema virus (CEV) (Ahmadivand et al., 2020; Badhusha et al., 2022; Kafi et al., 2022). CyHV-2 and KHV were first reported in the Japanese goldfish (Carassius auratus) in 1995 (Jung & Miyazaki, 1995), and common carp (Cyprinus carpio) in Israel and USA in 1998 (Perelberg et al., 2003), respectively. Moreover, CEV initially reported in Japan in 1974 (Murakami, 1976), has become a global concern as it spreads through subclinical infections that evade disease screening, and the World Organization for Animal Health (WOAH) designated it as an emerging virus (WOAH, 2021). Although different viruses can cause the disease, the clinical signs observed in infected fish are similar in terms of having gill necrosis and deposits of thick mucus under the gill covers being the most prominent (Bergmann et al., 2006; Granzow et al., 2014; Zhu et al., 2019). It is noteworthy that even though these viruses were identified decades ago, they continue to spread worldwide (Bergmann et al., 2020; Ouyang et al., 2023).

In Korea, KHV has been identified as an endemic virus in koi carp (Gomez et al., 2011). Recently, two other viruses, CyHV-2 and CEV, have also been reported in Korea (Jung et al., 2022; Kim et al., 2018). To minimize the risk of disease outbreaks in cyprinids, it is essential to investigate the epidemiological tracking of these viruses through genetic relatedness analysis. This study aimed to investigate alloherpesviruses (CyHV-2 and -3) and poxvirus (CEV) in domestic and imported cyprinids from 2021 to 2022. The molecular epidemiology approach was utilized to investigate the origin of identified viruses through sequencing and phylogenetic analysis. Additionally, virus isolation and challenge tests were performed to address the pathogenicity of identified viruses.

Materials and Methods

Samples

Between 2021 and 2022, a total of 19 cyprinid groups comprising 375 individual samples were collected from local markets and aquaculture farms (Table 1). The collected groups included three domestic groups containing 30 common carp, 200 koi carp, and 40 goldfish, and two imported groups consisting of 76 koi carp, and 29 goldfish. The fish were transported to the laboratory alive, and fish were observed for external symptoms. Subsequently, the gill tissue of each fish was collected for virus detection and analysis.

Table 1. Detection of KHV, CEV, and CyHV-2 from Cyprinids between 2021 and 2022
Source Species Group code Date Sample number Body length (cm) Body weight (g) KHV CEV CyHV-2 Virus isolate2)
Thymidine kinase1) SphI-51) Partial 4a1) Helicase1)
Domestic Common carp GrCc-2204 APR-2022 30 5.88 ± 0.45 0.89 ± 0.36 ND ND ND ND ND
Koi carp GrKc-2104 APR-2021 10 5.54 ± 0.54 1.36 ±0.34 ND ND ND ND ND
JcKc-2104 APR-2021 10 15.05 ± 1.00 45.33 ± 9.16 ND ND ND ND ND
ScKc-2105 MAY-2021 30 9.90 ± 1.43 15.71 ± 6.46 29/30 (96.7%) 15/30 (50.0%) 2/30 (6.7%) ND ScKc-2105-K ScKc-2105-CE
BcKc-2106 JUN-2021 30 4.92 ± 0.12 0.85 ± 0.26 ND ND ND ND ND
BsKc-2109 SEP-2021 30 No data No data ND ND ND ND ND
ScKc-2204 APR-2022 30 13.97 ± 0.10 32.44 ± 8.68 ND ND ND ND ND
JcKc-2205 MAY-2022 30 13.8 ± 1.46 33.00 ± 8.87 ND ND ND ND ND
GhKc-2207 JUL-2022 30 17.10 ± 1.94 46.88 ± 17.70 ND 4/30 (13.3%) 25/30 (83.3%) ND GhKc-2207-K GhKc-2207-CE
Goldfish BsGf-2106 JUN-2021 20 10.83 ± 0.51 11.46 ± 1.81 ND ND ND ND ND
JcGf-2104 MAY-2021 10 No data No data ND ND ND ND ND
GrGf-2104 MAY-2021 10 No data No data ND ND ND ND ND
Imported (Thailand) Koi carp ThGf-2101C JAN-2021 8 9.16 ± 0.50 8.69 ± 1.07 ND ND ND ND ND
ThGf-2101D JAN-2021 8 6.66 ± 0.45 3.15 ± 0.65 ND ND ND ND ND
ThGf-2205E MAY-2022 30 8.05 ± 0.70 6.55 ± 1.48 ND ND ND ND ND
ThGf-2206F JUN-2022 30 8.89 ± 0.56 6.59 ± 1.05 ND ND ND ND ND
Goldfish ThGf-2101A JAN-2021 8 4.08 ± 0.18 2.28 ± 0.37 ND ND ND 2/8 (25.0%) ThGf-2101A-Cy
ThGf-2101B JAN-2021 8 7.53 ± 0.37 2.73 ± 0.23 ND ND ND 3/8 (37.5%) ThGf-2101B-Cy
ThGf-2107 JUL-2021 13 5.63 ± 0.29 5.97 ± 0.90 ND ND ND 12/13 (92.3%) ThGf-2107-Cy

1) Target gene for PCR amplification.

2) The virus isolates identified through PCR were denoted by the final one or two letters (K, CE, and Cy), which represent KHV, CEV, and CyHV-2, respectively.

KHV, koi herpesvirus; CEV, carp edema virus; CyHV-2, cyprinid herpesvirus-2; PCR, polymerase chain reaction; ND, not detected.

Download Excel Table
Polymerase chain reaction (PCR) assay for virus detection

Polymerase chain reaction (PCR) was conducted for CyHV-2, KHV, and CEV detection. Genomic DNA was extracted from gill tissue (50 mg) using the yesG Cell Tissue mini kit (Genesgen, Busan, Korea) according to the manufacturer’s protocol. The extracted DNA was used for PCR analyses. PCR was conducted with a total volume of 20 µL containing 10 µL taq polymerase (Prime Taq Premix, Daejeon, Korea), 1 µL of DNA template, 7 µL of DEPC treated water, and 1 µL each of primer sets. The primer information and the PCR conditions for detecting each virus are described in Table 2.

Table 2. Primers used in this study
Target virus Target gene Primer Sequence (5′ to 3′) Length Condition Object Reference
KHV Thymidine kinase TK-F GGGTTACCTGTACGAG 409 94°C, 5 min, 40 cycles (94°C, 1 min, 55°C, 1 min, 72°C, 1 min), 72°C, 10 min Detection Bercovier et al., 2005
TK-R CACCCAGTAGAT TATGC
Enlarged TK gene-F AACGCGGGCCAGCTGAACAT 1,001 94°C, 5 min, 40 cycles (94°C, 1 min, 58°C, 1 min, 72°C, 1 min), 72°C, 10 min Sequencing Kurita et al., 2009
Enlarged TK gene-R TGTGTGTATCCCAATAAACG
SphI-5 Gray sph-F GACACCACATCTGCAAGGAG 292 94°C, 30 s, 40 cycles (94°C, 30 sec, 63°C, 30 sec, 72°C, 30 sec), 72°C, 7 min Detection Gray et al., 2002
Gray sph-R GACACATGTTACAATGGTCGC
KpnI/SacI fragment KHV-86f GACGCCGGAGACCTTGTG 78 50°C, 2 min, 95°C, 10 min, 40 cycles (95°C, 15 sec, 60°C, 60 sec) Detection and quantification Gilad et al., 2004
KHV-163r CGGGTTCTTATTTTTGTCCTTGTT
KHV-109p CTTCCTCTGCTCGGCGAGCACG
CEV Partial 4a CEV For B ATGGAGTATCCAAAGTACTTAG 528 94°C, 3 min, 40 cycles (95°C, 30 sec, 55°C, 30 sec, 72°C, 30 sec), 72°C, 10 min Detection and sequencing Matras et al., 2017
CEV Rev J CTCTTCACTATTGTGACTTTG
CyHV-2 Helicase CyHV-2 HelF GGACTTGCGAAGAGTTTGATTTCTAC 366 94°C, 5 min, 35 cycles (94°C, 1 min, 60°C, 1 min, 72°C, 1 min), 72°C, 10 min Detection and sequencing Waltzek et al., 2009
CyHV-2 HelR CCATAGTCACCATCGTCTCATC
Marker A oPVP382 CCACTTAGAGTAACCACTTAGAG 475 94°C, 8 min, 35 cycles (94°C, 30 sec, 58°C, 30 sec, 72°C, 30 sec), 72°C, 10 min Sequencing Boitard et al., 2016
oPVP383 GCGTTGACTCATTTGCGGTTTG

KHV, koi herpesvirus; CEV, carp edema virus; CyHV-2, cyprinid herpesvirus-2.

Download Excel Table
Sequence analysis and phylogeny analysis

To determine the genetic characteristics of the cyprinid virus identified by PCR, we performed sequencing and phylogeny analysis based on the enlarged thymidine kinase (TK) gene of KHV, p4a gene (putative major core protein) of CEV, and marker A gene of CyHV-2, respectively. PCR was conducted as described in Table 2. PCR amplicons were sequenced using an ABI3730XL DNA Analyzer (Applied Biosystems, Waltham, MA, USA), and the nucleotide homology was confirmed using the National Center for Biotechnology Information (NCBI) website with Basic Local Alignment Search Tool (BLAST) program (http://www.ncbi.nlm.nih.gov/BLAST). The phylogenetic tree was constructed by the maximum likelihood method with 1,000 bootstrap values using MEGA software (ver.11.0.10, MEGA International, Paris, France).

Virus isolation

To isolate the PCR-detected virus, the common carp brain (CCB) and koi carp fin (KF-1) cells were used. A total of 20 mg of PCR-positive gill samples were homogenized in 1 mL of phosphate-buffered saline solution and then centrifuged at 15,000×g for 10 min at 4°C. The resulting supernatant was collected and diluted in 5 mL of Eagle’s minimal essential medium (MEM; Gibco, New York, NY, USA) supplemented with 2% fetal bovine serum (FBS) and Leibovitz’s L-15 medium (L-15; Gibco) supplemented with 2% FBS, respectively. And then, diluted homogenates were filtered through 0.45 µm syringe filter. The filtered homogenate was used as an inoculum (MEM- and L-15 inoculum). The inoculum was inoculated to CCB cells (MEM-inoculum) and KF-1 cells (L-15 inoculum) that formed confluency of approximately 90% at 25-cm2 tissue culture flask (SPL, Pocheon, Korea) followed by incubation at 23°C. After the appearance of a cytopathic effect or after 14 days post-inoculation, the supernatant was collected and DNA was extracted. The DNA was used for the PCR template for confirmation of virus isolation. The primer sets and the PCR conditions are listed in Table 2.

Challenge test

For the challenge test, only KHV was used for experimental infection. Before the challenge test, healthy koi carp (mean body length, 6.74 ± 0.91 cm; mean body weight, 4.92 ± 0.96 g) were obtained from an aquafarm in Seosan and confirmed free of cyprinid viruses (CyHV-2, KHV, and CEV) by PCR analysis described above. The fish were acclimatized for 10 days at 23°C in a 100 L tank. Koi carp were intraperitoneally injected with 100 µL of cultured KHV (ScKc-2105-K) at a concentration of 102.6 TCID50/fish (n = 50). As a negative control, MEM medium alone was intraperitoneally injected into 50 koi carp. After the viral challenge, the fish were maintained at 23°C in 50 L tanks with 50% water exchange daily and were fed twice a day. Mortality was observed over 14 days, and the gill tissue was collected from all dead and surviving fish. The total DNA was extracted using the yesG Cell Tissue mini kit. The KHV genome copy was measured by real-time PCR (Table 2). All animal experiments were performed according to the Animal Research and Ethics Committees of Pukyong National University guidelines (Permission No. PKNUIACUC-2021-23).

Results and Discussion

Herein, we investigated CyHV-2, KHV, and CEV in 19 different cyprinid groups. CyHV-2 was detected only in goldfish imported from Thailand (Table 1), and three groups of these goldfish (ThGf-2101A, ThGf-2101B, and ThGf-2107) were identified as harboring CyHV-2 without any specific external symptoms. The detection rates for CyHV-2 in these groups were 25.0% (2/8), 37.5% (3/8), and 92.3% (12/13), respectively. In a previous study (Boitard et al., 2016), it was suggested that the marker A region containing tandem repetitive sequences could be used for epidemiological source tracking of CyHV-2. Notably, three CyHV-2 isolates (ThGf-2107-Cy, ThGf-2101A-Cy, and ThGf-2101B-Cy) identified from goldfish reveal diverse repetitive sequence sizes (Table 3), despite being grouped within the same clades as isolates from various geographical regions, including China, France, Poland, and Israel (Fig. 1). Interestingly, while ThGf-2101A-Cy and ThGf-2101B-Cy were closely related to Chinese isolates (SY, SY-C1, and 1301) with 33 bp repeating sequences, ThGf-2107-Cy showed a perfect match with isolates from France (FR), China (YZ-01, CCNDF-TB2015), and Poland (RSD-PL). Recently, CyHV-2 was detected by helicase gene-specific PCR assay in both imported and domestically cultured goldfish in Korea (Song et al., 2018). Although the genetic relatedness with previously reported CyHV-2 could not be analyzed due to the lack of maker A gene sequences, the plausibility of the international trade of live goldfish contributing to the introduction of CyHV-2 in Korea could not be ruled out.

Table 3. Repetitive nucleotide sequences of marker A region for cyprinid herpesvirus-2 (CyHV-2)
Strain GenBank Accession No. Size (bp) Repetitive sequence Length Times
Reference
 ST-J1 JQ815364 432 GCGCGTGGCTTTCGGGTTTCGATTCCGAGTAACTCTCAGATGGGTAACTCCCTGAATAACTCGTTTGTGGCCGTTAGTGGCTGTTGC 87 2
 SaT-1 LC202021 462 TGCGTCACTGGGATGGGCGCGTGGCTTTCGGGTTTCGATTCCGAGTAACTCTCAGATGGGTAACTCCCTGAATAACTCGTTTGTGGCCGTTAGTGGCTGTTGCGCTATTTTGCGCTA 117 2
 SY-C1 KM200722 345 ATGGTTACTCTAAGTGGTCTTAATGGTTACTCT 33 2
 1301 KU199244 345 ATGGTTACTCTAAGTGGTCTTAATGGTTACTCT 33 2
 SY KT387800 345 ATGGTTACTCTAAGTGGTCTTAATGGTTACTCT 33 2
 AMS-3 LC202025 462 TGCGTCACTGGGATGGGCGCGTGGCTTTCGGGTTTCGATTCCGAGTAACTCTCAGATGGGTAACTCCCTGAATAACTCGTTTGTGGCCGTTAGTGGCTGTTGCGCTATTTTGCGCTA 117 2
 AMS-1 LC202022 462 TGCGTCACTGGGATGGGCGCGTGGCTTTCGGGTTTCGATTCCGAGTAACTCTCAGATGGGTAACTCCCTGAATAACTCGTTTGTGGCCGTTAGTGGCTGTTGCGCTATTTTGCGCTA 117 2
 AMS-6 LC202023 458 TGGTTACTCTAAGTGGTCTTAATGGTTACTCTTAATGGTTACTCTCAATGGTTACTCTCAATGGTTACTCTTAGTGGGTACTCTTAGTGGGTACTCTCAG 100 2
 CNDF-TB2015 MN201961 295 AATGGTTACTCTC 13 2
 YZ-01 MK260012 295 AATGGTTACTCTC 13 2
 AMS-08 LC202024 297 AATGGTTACTCTC 13 2
 RSD-PL KX852452 295 AATGGTTACTCTC 13 2
 FR 295 AATGGTTACTCTC 13 2
In this study
 ThGf-2101A-Cy 343 ATGGTTACTCTAAGTGGTCTTAATGGTTACTCT 33 2
 ThGf-2101B-Cy 343 ATGGTTACTCTAAGTGGTCTTAATGGTTACTCT 33 2
 ThGf-2107-Cy 295 AATGGTTACTCTC 13 2
Download Excel Table
fas-26-7-437-g1
Fig. 1. Phylogenetic analysis of the marker A region of cyprinid herpesvirus 2 (CyHV-2) identified from imported goldfish. The phylogenetic tree was constructed using the maximum likelihood algorithm with 1,000 bootstrap replicates using MEGA software (ver.11.0.10). The isolates (ThGf-2101A-Cy, ThGf-2101B-Cy, and ThGF2107-Cy) in this study are highlighted in bold and red.
Download Original Figure

Two groups of domestic koi carp (ScKc-2105 and GhKc-2207) were found to be co-infected with KHV and CEV, with different detection rates between groups (Table 1). In the ScKc-2105 group, KHV was detected more frequently than CEV (KHV-TK, 96.7%; KHV-Gs, 50.0%; CEV, 6.7%). While in the GhKc-2207 group, CEV was detected more frequently than KHV (KHV-TK, not detected; KHV-Gs, 13.3%; CEV, 83.3%). After transportation to the laboratory, the ScKc-2105 group suffered from high mortality rates (approximately 80% after three days) with typical symptoms of KHV infection including enophthalmos, gill discoloration, necrosis, and abnormal swimming (Fig. 2A2C). In contrast, the GhKc-2207 group survived after transportation but exhibited small ulcers, redness, and gill necrosis, which are general clinical signs of CEV infection (Fig. 2D2F). Recently, there have been reports of mass mortality events caused by coinfection of KHV/CEV globally (Adamek et al., 2019; Kim et al., 2020; Toffan et al., 2020). In this study, we also found cases of KHV/CEV coinfection in two different forms. The ScKc-2105 group was identified as KHV dominant KHV/CEV coinfection, while in the GhKc-2207 group, CEV was dominant. While each virus exhibited unique external symptoms, such as the presence of ulcers in CEV infection, the clinical manifestation of gill pathology was strikingly similar. Furthermore, there is an increasing trend in cases of coinfection of KHV and CEV (Adamek et al., 2019; Kim et al., 2020; Toffan et al., 2020; Tolo et al., 2021; Zrnčić et al., 2020). It is essential to continue investigating to avoid overlooking either KHV or CEV. Additionally, further research is necessary to determine the relationship between pathogenicity and coinfection.

fas-26-7-437-g2
Fig. 2. External examination of domestic koi carp (Cyprinus rubrofuscus) sampled from Suncheon in 2021 (ScKc-2105 group) and Gimhae in 2022 (GhKc-2207 group). Black arrows indicate clinical signs. (A) Enophthalmos, (B) gill necrosis, (C) the discoloration of gill filaments in ScKc-2105, (D) gill necrosis, (E) a small ulcer on the body, and (F) redness on the body in GhKc-2207 group.
Download Original Figure

Based on the phylogeny of the enlarged TK gene, KHVs were classified into Asian and European types (Kurita et al., 2009). In this study, partial sequences of the TK genes from two KHVs (ScKc-2105-K and GhKc-2207-K) showed 100% homology with previously reported Korean isolate (GenBank accession number MN545485). However, the PCR amplicon of the enlarged TK gene was only generated from the ScKc-2105-K, which grouped with Asian type and showed close relatedness to isolates from Japan, Indonesia, Belgium, Taiwan, and China (Fig. 3).

fas-26-7-437-g3
Fig. 3. Phylogenetic analysis of the enlarged thymidine kinase (TK) gene of koi herpesvirus (KHV) identified from domestic koi carp. The phylogenetic tree was constructed using the maximum likelihood algorithm with 1,000 bootstrap replicates using MEGA software (ver.11.0.10). Specific genogroups are denoted by different colors: Asian (red) and European types (blue). The isolate (ScKc-2105-K) in this study is highlighted in bold and red.
Download Original Figure

For the CEV, Adamek et al. (2017) has shown that CEV can be classified into three genotypes based on the phylogeny of the p4a gene: I, IIa, and IIb. Two CEVs from koi carp (ScKc-2105-CE and GhKc-2207-CE) were identified as belonging to the IIa genotype (Fig. 4). ScKc-2015-CE was found to be closely related to isolates from the United Kingdom, USA, India, and Poland. On the other hand, GhKc-2207-CE was found to be closely related to isolates from South Korea, the United Kingdom, China, and Germany. The detection of the IIa genotype in the CEVs along with their genetic proximity to isolates from various countries offers significant insights into the worldwide prevalence and variability of this virus. Moreover, this elucidates the evolutionary relationships and genetic heterogeneity of different CEVs, as well as deciphering the infection origins and transmission.

fas-26-7-437-g4
Fig. 4. Phylogenetic analysis of the p4a gene of carp edema virus (CEV) identified from domestic koi carp. The phylogenetic tree was constructed using the maximum likelihood algorithm with 1,000 bootstrap replicates using MEGA software (ver.11.0.10). Specific genogroups are denoted by different colors: I (blue), IIa (red) and IIb (black). The isolates (ScKc-2105-CE and GhKc-2207-CE) in this study are highlighted in bold and red.
Download Original Figure

Although two cell lines from cyprinids were used, only KHV (ScKc-2105-K) was successfully isolated from CCB cells (Fig. 5), while CyHV-2 and CEV were not isolated in either CCB or KF-1. In a previous study, it was found that CyHV-2 could be isolated from KF-1 cells with only two passages, but not from epithelioma papulosum cyprinid and fathead minnow cells (Wang et al., 2012). Despite several attempts, no highly permissive cells for CEV isolation were identified until recently. Therefore, we conducted challenge tests only with cultured KHV (ScKc-2105-K), as it was the only virus successfully isolated in CCB cells. The observation of cumulative mortality of 78.0% (39/50) in koi carp injected with cultured ScKc-2105-K at a concentration of 102.6 TCID50/fish (corresponding to 9.20 × 107 viral genome copies/fish) within 14 days post-injection (dpi), while no mortality was observed in the control group (Fig. 6), indicating that the ScKc-2105-K is highly pathogenic in koi carp. A similar result was reported by Miyazaki et al. (2008) in common carp, where a concentration of 102.3 TCID50/fish resulted in 80.0% cumulative mortality. The dead koi carp exhibited typical symptoms of KHVD, such as enophthalmos and gill discoloration (data not shown). The viral genome copy number in dead koi carp was below 104 copies per reaction (average: 9.14 × 102 viral genome copies/rxn; Fig. 6) between 1 and 9 dpi. However, after 9 dpi, the viral genome copies increased to over 107 copies per reaction (average: 1.13 × 107 viral genome copies/rxn). The difference in viral genome copy number between the early and late stages of infection in koi carp may be due to either insufficient viral replication or differences in immune resistance during the early stages of infection.

fas-26-7-437-g5
Fig. 5. CPE of ScKc-2105-K in CCB cells (A) at 14 days post-inoculation, (B) mock cells. CPE, cytopathic effect; CCB, common carp brain (bar = 100 μm).
Download Original Figure
fas-26-7-437-g6
Fig. 6. Cumulative mortality (%) of koi carp after intraperitoneal injection with KHV (ScKc-2105-K) and MEM (negative control). The viral genome copies in gill tissue from dead fish after injection with KHV were denoted as black triangles. KHV, koi herpesvirus; MEM, minimal essential medium.
Download Original Figure

This study aimed to investigate the presence of alloher-pesviruses (CyHV-2 and KHV) and poxvirus (CEV) in cyprinids. CyHV-2 was only detected in imported goldfish from Thailand, which suggests that the transmission of viral disease in cyprinids may be facilitated through international trade. Notably, the detection of two distinct forms of KHV/CEV coinfection in domestic koi carp indicates the complex nature of viral interactions in fish populations and the need for further research to understand the underlying mechanisms involved. Furthermore, these findings emphasize the importance of ongoing surveillance and monitoring of fish viruses to prevent and manage outbreaks.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This research was supported by the Korea Institute of Marine Science & Technology Promotion (KIMST) and funded by the Ministry of Oceans and Fisheries, Korea (201903922).

Acknowledgements

Not applicable.

Availability of data and materials

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Ethics approval and consent to participate

All animal experiments were performed according to the Animal Research and Ethics Committees of Pukyong National University guidelines (Permission No. PKNUIACUC-2021-23).

References

1.

Adamek M, Oschilewski A, Wohlsein P, Jung-Schroers V, Teitge F, Dawson A, et al. Experimental infections of different carp strains with the carp edema virus (CEV) give insights into the infection biology of the virus and indicate possible solutions to problems caused by koi sleepy disease (KSD) in carp aquaculture. Vet Res. 2017; 48:12

2.

Adamek M, Teitge F, Steinhagen D. Quantitative diagnostics of gill diseases in common carp: not as simple as it seems. Dis Aquat Organ. 2019; 134:197-207

3.

Ahmadivand S, Soltani M, Shokrpoor S, Rahmati-Holasoo H, El-Matbouli M, Taheri-Mirghaed A. Cyprinid herpesvirus 3 (CyHV-3) transmission and outbreaks in Iran: detection and characterization in farmed common carp. Microb Pathog. 2020; 149:104321

4.

Badhusha A, Ahmed AN, Suryakodi S, Wazith MJA, Mithra S, Kanimozhi K, et al. First report on the occurrence of cyprinid herpesvirus 3 in koi carp (Cyprinus carpio koi) in India. J Fish Dis. 2022; 45:1087-98

5.

Bercovier H, Fishman Y, Nahary R, Sinai S, Zlotkin A, Eyngor M, et al. Cloning of the koi herpesvirus (KHV) gene encoding thymidine kinase and its use for a highly sensitive PCR based diagnosis. BMC Microbiol. 2005; 5:13

6.

Bergmann SM, Jin Y, Franzke K, Grunow B, Wang Q, Klafack S. Koi herpesvirus (KHV) and KHV disease (KHVD):a recently updated overview. J Appl Microbiol. 2020; 129:98-103

7.

Bergmann SM, Kempter J, Sadowski J, Fichtner D. First detection, confirmation and isolation of koi herpesvirus (KHV) in cultured common carp (Cyprinus carpio L.) in Poland. Bull Eur Assoc Fish Pathol. 2006; 26:97.

8.

Boitard PM, Baud M, Labrut S, de Boisséson C, Jamin M, Bigarré L. First detection of cyprinid herpesvirus 2 (CyHV‐2) in goldfish (Carassius auratus) in France. J Fish Dis. 2016; 39:673-80

9.

Gilad O, Yun S, Zagmutt-Vergara FJ, Leutenegger CM, Bercovier H, Hedrick RP. Concentrations of a koi herpesvirus (KHV) in tissues of experimentally-infected Cyprinus carpio koi as assessed by real-time TaqMan PCR. Dis Aquat Organ. 2004; 60:179-87

10.

Gomez DK, Joh SJ, Jang H, Shin SP, Choresca CH, Han JE, et al. Detection of koi herpesvirus (KHV) from koi (Cyprinus carpio koi) broodstock in South Korea. Aquaculture. 2011; 311:42-7

11.

Granzow H, Fichtner D, Schütze H, Lenk M, Dresenkamp B, Nieper H, et al. Isolation and partial characterization of a novel virus from different carp species suffering gill necrosis: ultrastructure and morphogenesis. J Fish Dis. 2014; 37:559-69

12.

Gray WL, Mullis L, LaPatra SE, Groff JM, Goodwin A. Detection of koi herpesvirus DNA in tissues of infected fish. J Fish Dis. 2002; 25:171-8

13.

Jung MH, Ryu JW, Nikapitiya C, Jung SJ. Detection of herpesviral hematopoietic necrosis virus (cyprinid herpesvirus 2, CyHV-2) from goldfish, Carassius auratus (L.) in Korea. Fish Aquat Sci. 2022; 25:403-8

14.

Jung SJ, Miyazaki T. Herpesviral haematopoietic necrosis of goldfish, Carassius auratus (L.). J Fish Dis. 1995; 18:211-20

15.

Kafi ZZ, Najafi H, Alishahi M, Rahmati-Holasoo H, Mouloki A, Ghalyanchilangeroudi A. Detection and phylogenetic analysis of carp edema virus in common carp (Cyprinus carpio) in Iran; 2020–2021. Aquaculture. 2022; 558:738381

16.

Kim SW, Giri SS, Kim SG, Kwon J, Oh WT, Park SC. Carp edema virus and cyprinid herpesvirus-3 coinfection is associated with mass mortality of koi (Cyprinus carpio haematopterus) in the Republic of Korea. Pathogens. 2020; 9:222

17.

Kim SW, Jun JW, Giri SS, Chi C, Yun S, Kim HJ, et al. First report of carp oedema virus infection of koi (Cyprinus carpio haematopterus) in the Republic of Korea. Transbound Emerg Dis. 2018; 65:315-20

18.

Kurita J, Yuasa K, Ito T, Sano M, Hedrick RP, Engelsma MY, et al. Molecular epidemiology of koi herpesvirus. Fish Pathol. 2009; 44:59-66

19.

Matras M, Borzym E, Stone D, Way K, Stachnik M, Maj‐Paluch J, et al. Carp edema virus in Polish aquaculture: evidence of significant sequence divergence and a new lineage in common carp Cyprinus carpio (L.). J Fish Dis. 2017; 40:319-25

20.

Miyazaki T, Yasumoto S, Kuzuya Y, Yoshimura T. A primary study on oral vaccination with liposomes entrapping koi herpesvirus (KHV) antigens against KHV infection in carp. Dis Asian Aquac. 2008; 7:99-184.

21.

Murakami Y. Studies on mass mortality of juvenile carp: about mass mortality showing edema. Hiroshima: Additional Publication of Bulletin Hiroshima Freshwater Fisheries Experimental Station. 1976CiNii article’s CRID: 1573668924612506624.

22.

Ouyang P, Ren Y, Zhou Y, Li Q, Huang X, Chen D, et al. Characteristics of pathology and transcriptome profiling reveal features of immune response of acutely infected and asymptomatic infected of carp edema virus in koi. Front Immunol. 2023; 14:1142830

23.

Perelberg A, Smirnov M, Hutoran M, Diamant A, Bejerano Y, Kotler M. Epidemiological description of a new viral disease afflicting cultured Cyprinus carpio in Israel. Isr J Aquac Bamidgeh. 2003; 55:5-12

24.

Song HD, Park JS, Kwon SR. Molecular evidence of cyprinid herpesvirus 2 (CyHV-2) in domestic goldfish Carrassius auratus and imported pearlscale goldfish Carassius auratus. Korean J Fish Aquat Sci. 2018; 51:383-8.

25.

Toffan A, Marsella A, Abbadi M, Abass S, Al‐Adhadh B, Wood G, et al. First detection of koi herpesvirus and carp oedema virus in Iraq associated with a mass mortality in common carp (Cyprinus carpio). Transbound Emerg Dis. 2020; 67:523-8

26.

Tolo IE, Padhi SK, Hundt PJ, Bajer PG, Mor SK, Phelps NBD. Host range of carp edema virus (CEV) during a natural mortality event in a minnesota lake and update of CEV associated mortality events in the USA. Viruses. 2021; 13:400

27.

Waltzek TB, Kurobe T, Goodwin AE, Hedrick RP. Development of a polymerase chain reaction assay to detect cyprinid herpesvirus 2 in goldfish. J Aquat Anim Health. 2009; 21:60-7

28.

Wang L, He J, Liang L, Zheng X, Jia P, Shi X, et al. Mass mortality caused by cyprinid herpesvirus 2 (CyHV-2) in Prussian carp (Carassius gibelio) in China. Bull Eur Assoc Fish Pathol. 2012; 32:164-73.

29.

World Organisation for Animal Health [WOAH]. Report of the meeting of the OIE aquatic animal health standards commission [Internet]. OIE. 2021[cited 2023 May 3]https://www.woah.org/app/uploads/2021/05/a-aac-feb-2021-part-b-1.pdf.

30.

Zhu M, Li K, Xuan Y, Sun Z, Liu B, Kumar D, et al. Host range and vertical transmission of cyprinid herpesvirus 2. Turk J Fish Aquat Sci. 2019; 19:645-52

31.

Zrnčić S, Oraić D, Zupičić IG, Pavlinec Ž, Brnić D, Rogić ŽA, et al. Koi herpesvirus and carp edema virus threaten common carp aquaculture in Croatia. J Fish Dis. 2020; 43:673-85

Website Renewal Notice


Our website has recently been renewed.

In some cases, images, CSS files, or other settings saved in your browser from previous visits may be reused instead of downloading the latest files. As a result, some pages may temporarily appear incorrectly or may not display properly.

If this occurs, please perform a hard refresh.

 - Windows: Ctrl + F5
 - Mac: Command + Shift + R

If you encounter any errors or difficulties while using the website, please contact us at info@guhmok.com.

Thank you.


I don't want to open this window for a day.