RESEARCH ARTICLE

Effects of feeding poly-β-hydroxybutyrate enriched Artemia nauplii on the growth, digestibility and immunity of Pacific white shrimp (Penaeus vannamei) post-larvae

Suhyeok Kim1https://orcid.org/0009-0003-8521-0428, Jaebeom Shin1https://orcid.org/0000-0002-4618-9414, Hyunwoon Lim1https://orcid.org/0000-0003-3050-2872, Daehyun Ko1https://orcid.org/0009-0000-1027-2358, Gunho Eom1https://orcid.org/0000-0003-4224-5885, Jongho Lim1https://orcid.org/0000-0003-1023-4313, Yeonji Lee1https://orcid.org/0009-0000-3782-2663, Sera Choi2, So Yun Park3, Jeung-Yil Park3, Kyeong-Jun Lee1,4,*https://orcid.org/0000-0003-0268-578X
Author Information & Copyright
1Department of Marine Life Science, Jeju National University, Jeju 63243, Korea
2Protein Solution Dept, CJ Cheiljedang BIO, Seoul 04560, Korea
3R&D, CJ Cheiljedang White BIO, Suwon 16495, Korea
4Marine Life Research Institute, Kidang Marine Science Institute, Jeju National University, Jeju 63333, Korea
*Corresponding author: Kyeong-Jun Lee, Department of Marine Life Science, Jeju National University, Jeju 63243, Korea, Tel: +82-64-754-3423, Fax: +82-64-756-3493, E-mail:kjlee@jejunu.ac.kr

Copyright © 2024 The Korean Society of Fisheries and Aquatic Science. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jan 25, 2024; Revised: Mar 07, 2024; Accepted: Mar 18, 2024

Published Online: Jul 31, 2024

Abstract

This study was conducted to investigate the effects of feeding Artemia nauplii enriched with poly-β-hydroxybutyrate (PHB) on Pacific white shrimp (Penaeus vannamei) post-larvae. A total 900 shrimp (initial average body weight: 2.50 ± 0.01 mg) were randomly distributed into 9 acrylic tanks (96 L) in triplicate groups. The Artemia reared in 0%, 0.25% and 0.50% PHB dissolved water (designated as Con, PHB25 and PHB50, respectively) were fed to the shrimp post-larvae for 14 days. The growth performance of shrimp was significantly higher in PHB25 and PHB50 groups than those in Con group. Survival was not significantly different among all the groups. Relative gene expressions of trypsin and amylase were significantly upregulated in PHB25 group than those of Con group. Relative gene expression of chymotrypsin was significantly upregulated in PHB25 and PHB50 groups compared to Con group. Relative gene expression of insulin-like growth factor-I was significantly upregulated in PHB25 group than in Con group. Relative gene expression of insulin-like growth factor-binding protein was significantly upregulated in both PHB25 and PHB50 groups than that of Con group. Relative expression of prophenoloxidase gene was significantly upregulated in PHB25 and PHB50 groups as compared to Con group. Relative expression of penaeidin-3a gene was significantly upregulated in PHB50 group as compared to Con group. This study demonstrated that PHB, as a functional nutritional enrichment for Artemia, improves the growth, digestibility and immunity of shrimp post-larvae.

Keywords: Poly-β-hydroxybutyrate; Penaeus vannamei; Pacific white shrimp post-larvae; Nutritional enrichment; Artemia

Introduction

Short-chain fatty acids (SCFA) such as acetate and butyrate are actively used as functional feed additives due to their positive effects on digestibility (Defoirdt et al., 2007). SCFA are known to improve immune response and disease resistance in aquatic animals such as rohu (Labeo rohita) (Baruah et al., 2005), red hybrid tilapia (Oreochromis sp.) (Koh et al., 2016) and crayfish (Procambarus clarkia) (Xiao et al., 2021). Also, Pacific white shrimp (Penaeus vannamei) fed SCFA-supplemented diet was reported to show a high disease resistance against Vibrio spp. (Duan et al., 2018; Pourmozaffar et al., 2017). SCFA are absorbed through the intestinal epithelium via passive diffusion and utilized in various metabolic pathways, notably contributing to energy production, such as adenosine triphosphate generation in the citric acid cycle (Lim et al., 2010). Thus, an efficient delivery of SCFA to the intestine is thought to be important. Unlike terrestrial animals, aquaculture feed is easily dissolved in the culture water, which makes it difficult for SCFA to effectively deliver to intestine (Defoirdt et al., 2009).

Poly-β-hydroxybutyrate (PHB) is a polymer that is synthesized by a wide range of microorganisms under conditions of physiological stress, such as nutrient limitation and carbon excess (Duan et al., 2017). PHB is a biodegradable plastic that was developed to reduce the environmental impact of the extensive accumulation of non-degradable plastic waste and is gaining interest in a variety of industrial sectors, including the packaging and medical industries (Shah et al., 2008). Recently, numerous studies have been dedicated to both effectively degrading PHB and exploring its effect as a feed additive on aquaculture. PHB has been studied as a potential feed additive in the aquafeed because of its beneficial functions on the growth, immunity and disease resistance of Nile tilapia (Oreochromis niloticus) (Situmorang et al., 2016), Pacific white shrimp (Kiran et al., 2020) and gibel carp (Carassius auratus gibelio) (Qiao et al., 2020). The growth-promoting effect of PHB as an Artemia enrichment was reported in giant river prawn (Macrobrachium rosenbergii) (Nhan et al., 2010), Siberian sturgeon (Acipenser baerii) (Najdegerami et al., 2012) and Chinese mitten crab (Eriocheir sinensis) (Sui et al., 2014). Gao et al. (2019) showed that the feeding of PHB-enriched Artemia to shrimp could improve their growth, survival, resistance against to V. anguillarum and tolerance to salinity shock. PHB can be biologically degraded to β-hydroxybutyric acid, a type of SCFA, by specific degradative enzymes in the intestines of aquatic animals and Freier et al. (2002) observed efficient degradation of PHB by digestive enzymes. The β-hydroxybutyric acid produced by the breakdown of PHB has been reported to play a beneficial role in the growth and immunity of aquatic animals (Duan et al., 2017; Situmorang et al., 2016). However, the information on the effects of PHB on gene expressions related to the growth, digestive enzymes and immunity is very limited in the shrimp at post-larvae stage.

Pacific white shrimp are one of the most important species in global shrimp aquaculture, due to their rapid growth and high resistance against environmental stressors even in the high-density cultures (Bardera et al., 2019). Successful production of high-quality larvae is one of the most important factors in the shrimp aquaculture. However, shrimp aquaculture has faced many challenges, such as critical diseases and water quality issues frome the high-density culture system leading to the increased mortality and the eventual low production (Walker & Mohan, 2009). In order to address these challenges and continue to improve the shrimp aquaculture industry, the development of effective feed additives is essential. Thus, this study was conducted to investigate the effects of feeding PHB-enriched Artemia on the growth performance and gene expressions related to the growth, digestive enzymes and innate immunity in Pacific white shrimp in post-larvae stage.

Materials and Methods

Artemia enrichment

PHB used for nutritional enrichment of Artemia was provided by CJ Cheiljedang (Seoul, Korea). Three Artemia groups consisted as non-enriched group (Con) and an enriched groups with 0.25% and 0.50% of PHB dissolved water (designated as PHB25 and PHB50, respectively). Artemia cysts (Sep-art Artemia, INVE, Salt Lake City, UT, USA) were hatched using an Artemia incubator (ZH-2000, Ziss Aqua, Osan, Korea). The hatching conditions were same as follows, density: 0.75 g/L, water temperature: 30.0 ± 0.5°C and salinity: 30.0 ± 0.5 psu. Artemia cysts were incubated for 24 h and decapsulated using a magnetic rod. After 2 h of Artemia hatching, 500 ml of PHB dissolved water was supplemented into Artemia tanks according to each concentration of larvae. Artemia was separated using a 0.18 mm sieve (Ziss EZ sieve SF-1, Ziss Aqua) and washed with fresh water to remove salinity and attached materials. The approximate composition of PHB-enriched Artemia were determined by standard procedures (AOAC, 2005) and the results were provided in Table 1. After enrichment, Artemia were observed under an optical microscope (DM750, Leica Microsystems, Heerbrugg, Switzerland) equipped with a digital camera (ICC 50 E, Leica Microsystems) to confirm enrichment (Fig. 1).

Table 1. Proximate composition (%, wet basis) of the Artemia nauplii in each treatment for the feeding trial of Pacific white shrimp (Penaeus vannamei) post-larvae
Diets Crude protein Crude lipid Crude ash Moisture
Con 3.96 ± 0.02 0.94 ± 0.03c 0.63 ± 0.03 89.5 ± 0.46
PHB25 3.96 ± 0.02 2.34 ± 0.01b 0.63 ± 0.02 89.0 ± 0.45
PHB50 4.07 ± 0.11 3.98 ± 0.03a 0.63 ± 0.01 90.2 ± 1.09
p-value 0.795 0.000 0.992 0.396

The Artemia nauplii was enriched with different levels of poly-β-hydroxybutyrate by 0, 0.25 and 0.5% (designated as Con, PHB25 and PHB50, respectively).

Values (mean ± SD) are average of triplicates (n = 3). Values with different superscripts in the same column are significantly different (p < 0.05).

Download Excel Table
fas-27-7-447-g1
Fig. 1. Microscopic visualization of the gut filling of Artemia nauplii after 2 h enrichment with PHB. (A) control or (B) PHB-enriched Artemia nauplii. Scale bar: 500 µm; Original magnification × 40.
Download Original Figure
Experimental condition

Pacific white shrimp post-larvae were obtained from Daedong Susan (Muan-gun, Korea). After acclimation to the experimental condition, 900 shrimp were randomly placed as triplicate groups in 9 acrylic tanks (96 L). The initial average body weight of the shrimp was 2.50 ± 0.01 mg and the initial average body length was 0.90 ± 0.01 cm. Dissolved oxygen (DO) in tank was maintained using aeration. The photoperiod was maintained at 12 light: 12 dark using a fluorescent lamp. The feeding trial was conducted for 14 days with experimental feed three times a day (07:00, 13:00 and 19:00 h). The daily feed amount was supplied referring to the method described by Alday-Sanz (2010), starting with 300 Artemia and increasing by 10% per day. Water temperature, DO (Pro20 Dissolved Oxygen Meter, YSI, Yellow Springs, OH, USA), salinity (Master-S28M Salinity Refractometer, ATAGO, Tokyo, Japan), pH (Seven Compact pH meter S210, Mettler Toledo, Columbus, OH, USA) and ammonia concentration (Strickland & Parsons, 1972) were measured daily during the experiment. During the feeding trial, the rearing conditions were followed: DO (6.59 ± 0.18 mg/L), salinity (32.1 ± 0.6 psu), pH (7.95 ± 0.10), water temperature (30.5 ± 0.5°C) and ammonia (0.02 ± 0.01 ppm).

Growth performance, survival and sample collection

After the feeding trial, weight and length measurements were taken for all shrimp in each tank. Based on the measurement results, final body weight (FBW), weight gain (WG), length gain (LG), specific growth rate (SGR) and survival were calculated. Then, 10 shrimps per tank (30 shrimps per experiment group) were randomly selected and anesthetized in ice water. The hepatopancreas was frozen using liquid nitrogen and then stored in a deep-freezer (–80°C). The hepatopancreas was analyzed for relative gene expression.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Hepatopancreatic RNA was extracted using TRI-zol® (93289, Sigma-Aldrich, St. Louis, MO, USA). The quantity and quality of total RNA were measured using a Nano drop 2000TM (Thermo Scientific, Wilmington, DE, USA). The 260/280 nm ratios of all samples ranged from 1.8 to 2.0; therefore, synthesis of cDNA was performed using the PrimeScriptTM RT reagent kit (TaKaRa Bio, Shiga, Japan). The synthesized cDNA was diluted 50-fold with nuclease-free water. The primer sequences of trypsin, chymotrypsin, amylase, insulin-like growth factor-I (IGF-I), insulin-like growth factor-binding protein (IGF-BP), prophenoloxidase (proPO) and penaeidin-3a (Pen-3a) used in the experiments are listed in Table 2. qPCR was performed using Real-Time System TP 950 Thermal Cycler DiceTM (TP950, TaKaRa Bio) and 2 μL of cDNA, 10 μL TaKaRa Ex TaqTMSYBR premix, 0.4 μL of forward & reverse primer and 7.2 μL of distilled water, with the total volume adjusted 20 μL for analysis. The analysis was carried out by adjusting the volume to 20 μL. qPCR was performed following the method of Lee et al. (2021). The relative levels of mRNA expression were calculated according to Pfaffl (2001) (2–ΔΔCT threshold cycles [CT]).

Table 2. Primers used for quantitative real-time PCR
Gene Sequence (5′-3′) Accession number
Trypsin-F TCCAAGATCATCCAACACGA Y15040
Trypsin-R GACCCTGAGCGGGAATATC
Chymotrypsin-F GGCTCTCTTCATCGACG X66415
Chymotrypsin-R CGTGAGTGAAGAAGTCGG
Amylase-F CAAACTGGTTGGGCTGAACG KM077135.1
Amylase-R TAGTACGACGACATCACGCG
IGF-I-F GGCTTCAGCGTCAGGTGTTCCC HAAW01015949
IGF-I-R ACCCTTCCCGCAGATGTAGCAG
IGF-BP-F GTGGGCAGGGACCAAATC KP420228
IGF-BP-R TCAGTTACCACCAGCGATT
proPO-F CGGTGACAAAGTTCCTCTTC AY723296
proPO-R GCAGGTCGCCGTAGTAAG
Pen-3a-F CACCCTTCGTGAGACCTTTG Y14926
Pen-3a-R AATATCCCTTTCCCACGTGAC
β-actin-F CCACGAGACCACCTACAAC AF300705.2
β-actin-R AGCGAGGGCACTGATTTC

IGF-I, insulin-like growth factor-I; IGF-BP, insulin-like growth factor-binding protein; proPO, prophenoloxidase; Pen-3a, penaeidin-3a.

Download Excel Table
Statistical analysis

The statistical analysis utilized one-way analysis of variance (ANOVA) and the results were presented as mean ± SD. Data of each parameter were initially checked for normality. The statistical analysis was conducted using SPSS 24.0 (IBM, NY, USA). The mean differences between groups were compared using Duncan’s multiple range test (p < 0.05). Prior to analysis, the percentage data were transformed to an arcsine value.

Results

FBW, WG, LG and SGR were significantly higher in PHB25 and PHB50 groups than those in Con group (Table 3). Survival was not significantly different among all the groups. Relative expressions of trypsin and amylase were significantly upregulated in PHB25 group than in Con group (Fig. 2). Relative expression of chymotrypsin was significantly upregulated in both PHB25 and PHB50 groups compared to Con group. Relative gene expression of IGF-I was significantly upregulated in PHB25 group than in Con group (Fig. 3). Relative gene expression of IGF-BP was significantly upregulated in both PHB25 and PHB50 groups than in Con group. The gene expression of proPO was significantly upregulated in PHB25 and PHB50 groups as compared to Con group (Fig. 4). Pen-3a gene expression was significantly upregulated in PHB50 group as compared to Con group.

Table 3. Growth performance and survival of Pacific white shrimp (Penaeus vannamei) post-larvae (initial mean body weight and length were 2.50 ± 0.01 mg and 0.90 ± 0.01 cm, respectively) fed Artemia nauplii enriched with different levels of poly-β-hydroxybutyrate (PHB) for 14 days
Diets FBW1) WG2) LG3) SGR4) Survival (%)
Con 27.9 ± 0.09c 1,016 ± 34.6c 83.6 ± 2.21c 17.2 ± 0.22c 90.3 ± 5.69
PHB25 34.7 ± 0.19a 1,287 ± 75.0a 93.8 ± 1.07a 18.8 ± 0.39a 89.3 ± 2.31
PHB50 31.4 ± 0.04b 1,155 ± 15.5b 89.1 ± 0.87b 18.1 ± 0.09b 91.3 ± 3.79
p-value 0.001 0.001 0.000 0.001 0.815

The Artemia nauplii was enriched with different levels of PHB by 0, 0.25 and 0.5% (designated as Con, PHB25 and PHB50, respectively).

Values (mean ± SD) are average of triplicates (n = 3). Values with different superscripts in the same column are significantly different (p < 0.05).

1) Final body weight (mg).

2) Weight gain (%) = [(Final body weight – Initial body weight) / Initial body weight] × 100.

3) Length gain (%) = [(Final body length – Initial body length) / Initial body length] × 100.

4) Specific growth rate (%) = [(Loge final body weight – Loge initial body weight) / days] × 100.

Download Excel Table
fas-27-7-447-g2
Fig. 2. Relative expression of digestive enzymes (trypsin, chymotrypsin and amylase) in hepatopancreas of Pacific white shrimp (Penaeus vannamei) fed Artemia nauplii enriched with two different levels of poly-β-hydroxybutyrate (PHB) for 14 days. Bars with different letters are significantly different (p < 0.05).
Download Original Figure
fas-27-7-447-g3
Fig. 3. Relative expression of growth-related genes, insulin-like growth factor-I (IGF-I) and insulin-like growth factor-binding protein (IGF-BP) in hepatopancreas of Pacific white shrimp (Penaeus vannamei) fed Artemia nauplii enriched with two different levels of poly-β-hydroxybutyrate (PHB) for 14 days. Bars with different letters are significantly different (p < 0.05).
Download Original Figure
fas-27-7-447-g4
Fig. 4. Relative expression of immune-related genes, prophenoloxidase (proPO) and penaeidin-3a (Pen-3a) in hepatopancreas of Pacific white shrimp (Penaeus vannamei) fed Artemia nauplii enriched with two different levels of poly-β-hydroxybutyrate (PHB) for 14 days. Bars with different letters are significantly different (p < 0.05).
Download Original Figure

Discussion

PHB is known to be decomposed into β-hydroxybutyrate, one of the SCFA, by intestinal microorganisms such as Acidovorax, Acinetobacter and Ochrobactrum genera (Duan et al., 2017; Liu et al., 2010). Butyrate, serving as the primary energy source for colonic epithelial cells, plays a pivotal role in influencing cell proliferation and modulating mucosal blood flow through the release of growth factors or gastrointestinal peptides like gastrin (Blottière et al., 2003; Lee et al., 2021). Additionally, butyrate provides energy to intestinal epithelial cells, increasing intestinal health and resistance to infection and increases nutrient digestibility by increasing digestive enzyme activity (Defoirdt et al., 2009). Dietary PHB supplementation was reported to improve the growth of Siberian sturgeon (Najdegerami et al., 2012), Chinese mitten crab (Sui et al., 2016) and Pacific white shrimp (Gao et al., 2019) by inhibiting proliferation of pathogens and/or promoting the proliferation of some beneficial bacteria such as Bacillus and Lactobacillus. PHB addition at levels of 5–10 g/kg to sea cucumber (Apostichopus japonicus) feed led to an increase in the abundance of Rhodobacteraceae, known to positively contributed on growth and health, alongside observed increases in amino acid, lipid and nucleotide metabolism, as predicted by functional analysis of the gut microbiota (Liu et al., 2022). Duan et al. (2017) found that the addition of PHB to the diet (30 g/kg) significantly raised butyrate levels in the gut, potentially as a source for energy production and lipid synthesis. Silva et al. (2016) reported that the dietary supplementation of butyrate and PHB at 20 g/kg diet was able to improve the growth, survival, intestinal, length and width of villi and digestive enzymes activity of Pacific white shrimp. Several studies have demonstrated that nutritional enrichment of PHB can be effectively delivered through Artemia as prey for fish or crustacean larvae. In fishes, the feeding of PHB enriched Artemia was reportedly demonstrated to increase the growth performance of European bass (Dicentrarchus labrax) (de Schryver et al., 2010) and Siberian sturgeon (Najdegerami et al., 2015). In crustaceans, the feeding Artemia enriched with PHB improved the growth and survival of giant river prawns (Nhan et al., 2010), Chinese mitten crab (Sui et al., 2014) and Pacific white shrimp (Gao et al., 2019). Notably, similar to our study, Nhan et al. (2010) reported that 0.5% nutrient enrichment with PHB in Artemia culture water increased the growth and survival of giant river prawns. Sui et al. (2014) reported that 100 mg/L of PHB in Artemia culture water can be effectively transferred to Chinese mitten crab, which is sufficiently concentrated in Artemia, and can enhance growth by beneficially affecting the bioavailability of minerals and trace elements required for growth in the gastrointestinal tract. Defoirdt et al. (2007) found that β-hydroxybutyrate degraded from PHB provides energy to produce a stronger intestinal epithelium, thereby protecting shrimp from infection by pathogens such as Vibrio spp. Based on precedent studies and our research findings, it is presumed that PHB effectively delivered into the intestines of shrimp via Artemia not only activates metabolism through energy provision, enhancing digestive enzyme activity and growth factor expression but also enhances beneficial bacteria countering pathogens, thus likely exerting a positive influence on the gut microbial ecosystem. Improvements in the gut microbial community are known to have positive effects on physiological functions like nutrient digestion, including amino acids, vitamins, mineral and lipids, and protection from pathogens (Merrifield & Ringø, 2014). Therefore, we maintain that PHB can be used as a nutrient enrichment for live feed to effectively promote their growth into Pacific white shrimp post-larvae.

Nutrient availability is directly related to the growth of animals and the activity of digestive enzymes is important for the nutrient digestion and absorption. Trypsin, chymotrypsin and amylase are the most abundant protein and carbohydrate enzymes in the hepatopancreas of shrimp and they are developed in the post-larvae stage (Roy et al., 2018). Silva et al. (2016) reported that the supplementation of PHB (20 g/kg) in Pacific white shrimp diet significantly improved the activity of trypsin, chymotrypsin and amylase. Duan et al. (2017) found that the activities of pepsin, trypsin, amylase and lipase were significantly improved by supplementing the diet of Pacific white shrimp with PHB (30 g/kg). Shrimp that consumed feed containing 10 g/kg PHB were found to have improved digestion and absorption through increased digestive enzyme activity and minimized waste production, resulting in WG (Kiran et al., 2020). The heightened activity of digestive enzymes when utilizing PHB as a feed additive or nutritional enrichment might be due to a decrease in the intestinal pH of shrimp. The breakdown of PHB polymers into β-hydroxybutyric acid monomer in the intestines was believed to impact the intestinal pH which was gradually decreased with increasing PHB levels (de Schryver et al., 2010). This pH reduction might enhance the activity of digestive enzymes, potentially improving the ability to digest and absorb nutrients from the feeds (Baruah et al., 2005). From our findings, we conclude that the upregulated gene expression of trypsin, chymotrypsin and amylase within the hepatopancreas of shrimp post-larvae fed PHB-enriched Artemia significantly impacts nutrient digestion and absorption, thereby contributing to the observed accelerated growth.

The insulin signaling pathway, essential for regulating metabolism, growth and development, involves IGF-BP and its receptor, which play pivotal roles in the biological functions of IGF, insulin and insulin-like peptides (Pang et al., 2021). Gutiérrez et al. (2007) reported that IGF-I levels in the hepatopancreas and muscle of Pacific white shrimp are involved in carbohydrate metabolism and are involved in cell metabolism and growth. IGF-BP regulates IGF activity and induces inhibition of apoptosis and enhances cell growth (Zhang et al., 2017). Shrimp fed a diet supplemented with 2 g/kg monobutyrin exhibited upregulated IGF-BP expression (Lee et al., 2021). In the present study, similar phenomenon was observed in shrimp fed PHB25 and PHB50 diets showing higher IGF-I and IGF-BP expressions than shrimp fed non-PHB diet. Thus, Artemia could be a good couriers of PHB in the promotion of IGF-I and IGF-BP gene expressions, which may help the shrimp growth.

The proPO activates phenoloxidase (PO), which plays important roles in the biosynthesis of melanin and inhibition of pathogenic toxin production (Sangsuriya et al., 2016). Duan et al. (2018) reported that the succinic acid supplementation at 5 g/kg diet in the Pacific white shrimp diet significantly enhanced proPO gene expression. Similar to the findings in our study, previous research reported that dietary supplementations for Pacific white shrimp with 3 g/kg of citric acid (Su et al., 2014) and 2 g/kg of tributyrin (Lee et al., 2021) were able to enhance the expressions of proPO and PO activities, effectively inhibiting Vibrio bacteria. Penaeidin is an important antimicrobial peptide in shrimp that exhibits potent antimicrobial activity against pathogenic microorganisms, including bacteria, fungi and viruses (Song & Li, 2014). He et al. (2017) reported that the supplementation of 0.9 g/kg of organic acid mixture (citric acid, 25%; sorbic acid, 16.7%, w/w) in Pacific white shrimp diet significantly improved their penaeidin expression and disease resistance against V. parahaemolyticus. Also, it was reported that the supplementation of propionic acid at 5 g/kg diet for Pacific white shrimp increased the activity of Pen-3a (Pourmozaffar et al., 2017). Therefore, our results clearly suggest that PHB could be used as an effective immunostimulants in shrimp diet.

In conclusion, the findings from this study support that the growth of shrimp can be improved by feeding PHB-enriched Artemia. The gene expressions of trypsin, chymotrypsin, amylase, IGF-I and IGF-BP in the shrimp were upregulated by feeding the PHB-enriched Artemia, suggesting that Artemia serves as an effective vehicle for PHB delivery to the shrimp. Additionally, PHB appears to affect proPO and Pen-3a gene expressions indicating its potential as an immunostimulant for the shrimp. This study demonstrated that PHB acts as a functional nutritional enrichment for post-larvae Pacific white shrimp growth, digestibility and immunity. However, further research is needed on the optimal PHB concentration for nutritional enhancement to improve larval production efficiency.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This study was funded by CJ Cheiljedang Co., Ltd and Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2019R1A6A1A03033553).

Acknowledgements

Not applicable.

Availability of data and materials

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Ethics approval and consent to participate

The protocols of this feeding trial were evaluated and approved by the Institutional Animal Care and Use Committee of Jeju National University.

References

1.

Alday-Sanz V. The shrimp book. Nottingham: Nottingham University Press. 2010; p p. 329

2.

Association of Official Analytical Chemists [AOAC]. Official method of analysis of the Association of Official Analytical Chemists. 18th ed Arlington, VA: AOACInternational. 2005.

3.

Bardera G, Usman N, Owen M, Pountney D, Sloman KA, Alexander ME. The importance of behaviour in improving the production of shrimp in aquaculture. Rev Aquac. 2019; 11:1104-32

4.

Baruah K, Pal AK, Sahu NP, Jain KK, Mukherjee SC, Debnath D. Dietary protein level, microbial phytase, citric acid and their interactions on bone mineralization of Labeo rohita (Hamilton) juveniles. Aquac Res. 2005; 36:803-12

5.

Blottière HM, Buecher B, Galmiche JP, Cherbut C. Molecular analysis of the effect of short-chain fatty acids on intestinal cell proliferation. Proc Nutr Soc. 2003; 62:101-6

6.

de Schryver P, Sinha AK, Kunwar PS, Baruah K, Verstraete W, Boon N, et al. Poly-β-hydroxybutyrate (PHB) increases growth performance and intestinal bacterial range-weighted richness in juvenile European sea bass, Dicentrarchus labrax. Appl Microbiol Biotechnol. 2010; 86:1535-41

7.

Defoirdt T, Boon N, Sorgeloos P, Verstraete W, Bossier P. Alternatives to antibiotics to control bacterial infections: luminescent vibriosis in aquaculture as an example. Trends Biotechnol. 2007; 25:472-9

8.

Defoirdt T, Boon N, Sorgeloos P, Verstraete W, Bossier P. Short-chain fatty acids and poly-β-hydroxyalkanoates: (new) biocontrol agents for a sustainable animal production. Biotechnol Adv. 2009; 27:680-5

9.

Duan Y, Wang Y, Zhang J, Sun Y, Wang J. Dietary effects of succinic acid on the growth, digestive enzymes, immune response and resistance to ammonia stress of Litopenaeus vannamei. Fish Shellfish Immunol. 2018; 78:10-7

10.

Duan Y, Zhang Y, Dong H, Zheng X, Wang Y, Li H, et al. Effect of dietary poly-β-hydroxybutyrate (PHB) on growth performance, intestinal health status and body composition of Pacific white shrimp Litopenaeus vannamei (Boone, 1931). Fish Shellfish Immunol. 2017; 60:520-8

11.

Freier T, Kunze C, Nischan C, Kramer S, Sternberg K, Saß M, et al. In vitro and in vivo degradation studies for development of a biodegradable patch based on poly (3-hydroxybutyrate). Biomaterials. 2002; 23:2649-57

12.

Gao M, Du D, Bo Z, Sui L. Poly-β-hydroxybutyrate (PHB)-accumulating Halomonas improves the survival, growth, robustness and modifies the gut microbial composition of Litopenaeus vannamei postlarvae. Aquaculture. 2019; 500:607-12

13.

Gutiérrez A, Nieto J, Pozo F, Stern S, Schoofs L. Effect of insulin/IGF-I like peptides on glucose metabolism in the white shrimp Penaeus vannamei. Gen Comp Endocrinol. 2007; 153:170-5

14.

He W, Rahimnejad S, Wang L, Song K, Lu K, Zhang C. Effects of organic acids and essential oils blend on growth, gut microbiota, immune response and disease resistance of Pacific white shrimp (Litopenaeus vannamei) against Vibrio parahaemolyticus. Fish Shellfish Immunol. 2017; 70:164-73

15.

Kiran GS, Priyadharshini S, Sajayan A, Ravindran A, Priyadharshini GB, Ramesh U, et al. Dietary administration of gelatinised polyhydroxybutyrate to Penaeus vannamei improved growth performance and enhanced immune response against Vibrio parahaemolyticus. Aquaculture. 2020; 517:734773

16.

Koh CB, Romano N, Zahrah AS, Ng WK. Effects of a dietary organic acids blend and oxytetracycline on the growth, nutrient utilization and total cultivable gut microbiota of the red hybrid tilapia, Oreochromis sp., and resistance to Streptococcus agalactiae. Aquac Res. 2016; 47:357-69

17.

Lee C, Shin J, Feyaerts J, Shin J, Kim MG, Gunathilaka BE, et al. Effects of dietary supplementation of monobutyrin and tributyrin on growth, feed efficiency, innate immunity, digestibility and disease resistance of Pacific white shrimp (Litopenaeus vannamei) against Vibrio harveyi. Aquac Nutr. 2021; 27:771-81

18.

Lim C, Luckstadt C, Klesius P. Use of organic acids, salts in fish diets. Glob Aquac Advocate. 2010; 13:45-6.

19.

Liu L, Wang M, Wei C, Liu Y, Pan M, Wang S, et al. Effects of dietary poly-β-hydroxybutyrate supplementation on the growth, non-specific immunity, and intestinal microbiota of the sea cucumber Apostichopus japonicus. Front Mar Sci. 2022; 9:855938

20.

Liu Y, De Schryver P, Van Delsen B, Maignien L, Boon N, Sorgeloos P, et al. PHB-degrading bacteria isolated from the gastrointestinal tract of aquatic animals as protective actors against luminescent vibriosis. FEMS Microbiol Ecol. 2010; 74:196-204

21.

Merrifield D, Ringø E. Aquaculture nutrition: gut health, probiotics and prebiotics. Oxford: John Wiley & Sons. 2014

22.

Najdegerami EH, Baruah K, Shiri A, Rekecki A, Van den Broeck W, Sorgeloos P, et al. Siberian sturgeon (Acipenser baerii) larvae fed Artemia nauplii enriched with poly‐β‐hydroxybutyrate (PHB): effect on growth performance, body composition, digestive enzymes, gut microbial community, gut histology and stress tests. Aquac Res. 2015; 46:801-12

23.

Najdegerami EH, Tran TN, Defoirdt T, Marzorati M, Sorgeloos P, Boon N, et al. Effects of poly-β-hydroxybutyrate (PHB) on Siberian sturgeon (Acipenser baerii) fingerlings performance and its gastrointestinal tract microbial community. FEMS Microbiol Ecol. 2012; 79:25-33

24.

Nhan DT, Wille M, De Schryver P, Defoirdt T, Bossier P, Sorgeloos P. The effect of poly-β-hydroxybutyrate on larviculture of the giant freshwater prawn Macrobrachium rosenbergii. Aquaculture. 2010; 302:76-81

25.

Pang Y, Zhang X, Yuan J, Zhang X, Xiang J, Li F. Characterization and expression analysis of insulin growth factor binding proteins (IGFBPs) in Pacific white shrimp Litopenaeus vannamei. Int J Mol Sci. 2021; 22:1056

26.

Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001; 29e45

27.

Pourmozaffar S, Hajimoradloo A, Miandare HK. Dietary effect of apple cider vinegar and propionic acid on immune related transcriptional responses and growth performance in white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2017; 60:65-71

28.

Qiao G, Chen P, Sun Q, Zhang M, Zhang J, Li Z, et al. Poly-β-hydroxybutyrate (PHB) in bioflocs alters intestinal microbial community structure, immune-related gene expression and early Cyprinid herpesvirus 2 replication in gibel carp (Carassius auratus gibelio). Fish Shellfish Immunol. 2020; 97:72-82

29.

Roy S, Kumar V, Mitra A, Manna RK, Suresh VR, Homechaudhuri S. Amylase and protease activity in shrimps and prawn of Sundarbans, West Bengal, India. Indian J Geo Mar Sci. 2018; 47:53-9.

30.

Sangsuriya P, Charoensapsri W, Chomwong S, Senapin S, Tassanakajon A, Amparyup P. A shrimp pacifastin light chain-like inhibitor: molecular identification and role in the control of the prophenoloxidase system. Dev Comp Immunol. 2016; 54:32-45

31.

Shah A, Hasan F, Hameed A, Ahmed S. A novel poly(3-hydroxybutyrate)-degrading Streptoverticillium kashmirense AF1 isolated from soil and purification of PHB-depolymerase. Acta Biol Hung. 2008; 59:489-99

32.

Silva BC, Jesus GFA, Seiffert WQ, Vieira FN, Mouriño JLP, Jatobá A, et al. The effects of dietary supplementation with butyrate and polyhydroxybutyrate on the digestive capacity and intestinal morphology of Pacific white shrimp (Litopenaeus vannamei). Mar Freshw Behav Physiol. 2016; 49:447-58

33.

Situmorang ML, De Schryver P, Dierckens K, Bossier P. Effect of poly-β-hydroxybutyrate on growth and disease resistance of Nile tilapia Oreochromis niloticus juveniles. Vet Microbiol. 2016; 182:44-9

34.

Song YL, Li CY. Shrimp immune system-special focus on penaeidin. J Mar Sci Technol. 2014; 22:1.

35.

Strickland JDH, Parsons TR. A practical handbook of seawater analysis. Bulletin 167. 2nd ed Ottawa, ON: Fisheries Research Board of Canada. 1972.

36.

Su X, Li X, Leng X, Tan C, Liu B, Chai X, et al. The improvement of growth, digestive enzyme activity and disease resistance of white shrimp by the dietary citric acid. Aquac Int. 2014; 22:1823-35

37.

Sui L, Liu Y, Sun H, Wille M, Bossier P, De Schryver P. The effect of poly‐β‐hydroxybutyrate on the performance of Chinese mitten crab (Eriocheir sinensis Milne‐Edwards) zoea larvae. Aquac Res. 2014; 45:558-65

38.

Sui L, Ma G, Lu W, Deng Y, Bossier P, De Schryver P. Effect of poly-β-hydroxybutyrate on growth, enzyme activity and intestinal microbial community of Chinese mitten crab, Eriocheir sinensis (Milne-Edwards) juveniles. Aquac Res. 2016; 47:3644-52

39.

Walker PJ, Mohan CV. Viral disease emergence in shrimp aquaculture: origins, impact and the effectiveness of health management strategies. Rev Aquac. 2009; 1:125-54

40.

Xiao C, Zhang Y, Zhu F. Effect of dietary sodium butyrate on the innate immune response of Procambarus clarkii and disease resistance against white spot syndrome virus. Aquaculture. 2021; 541:736784

41.

Zhang H, Shi Y, He M. Molecular identification of an insulin growth factor binding protein (IGFBP) and its potential role in an insulin-like peptide system of the pearl oyster, Pinctada fucata. Comp Biochem Physiol B Biochem Mol Biol. 2017; 214:27-35

Website Renewal Notice


Our website has recently been renewed.

In some cases, images, CSS files, or other settings saved in your browser from previous visits may be reused instead of downloading the latest files. As a result, some pages may temporarily appear incorrectly or may not display properly.

If this occurs, please perform a hard refresh.

 - Windows: Ctrl + F5
 - Mac: Command + Shift + R

If you encounter any errors or difficulties while using the website, please contact us at info@guhmok.com.

Thank you.


I don't want to open this window for a day.